EMAIL THIS PAGE TO A FRIEND

HAUS7

HAUS augmin-like complex, subunit 7

86 Gene Product Result for
Synonyms: UCHL5IP UIP1
UniProtKB ID: Q99871, B4DUH6, D3DWT9, Q96HS8, Q9NP54, Q9UFH9
Gene ID:
Human(55559) Summary: This gene encodes a subunit of the augmin complex, which regulates centrosome and mitotic spindle integrity, and is necessary for the completion of cytokinesis. The encoded protein was identified by interaction with ubiquitin C-terminal hydrolase 37. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(73738) HAUS augmin-like complex, subunit 7
Rat(293844) HAUS augmin-like complex, subunit 7
Zebrafish(553483) HAUS augmin-like complex, subunit 7
domestic cat(101087212) HAUS augmin-like complex, subunit 7
Horse(100058557) HAUS augmin-like complex, subunit 7
cow(614404) HAUS augmin-like complex, subunit 7
dog(612496) HAUS augmin-like complex, subunit 7
sheep(101102128) HAUS augmin-like complex, subunit 7
domestic guinea pig(100713983) HAUS augmin-like complex, subunit 7
naked mole-rat(101711825) HAUS augmin-like complex, subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127701 MISSION® esiRNA esiRNA human UCHL5IP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017518 Rosetta Predictions human pricing
NM_207106 Rosetta Predictions human pricing
NM_207107 Rosetta Predictions human pricing
NM_001110488 Rosetta Predictions rat pricing
NM_028633 Rosetta Predictions mouse pricing
NM_207104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350136 predicted 764
2 SASI_Hs02_00350137 predicted 772
3 SASI_Hs01_00067984 predicted 483
4 SASI_Hs01_00067985 predicted 432
5 SASI_Hs01_00067987 predicted 339
6 SASI_Hs01_00067988 predicted 267
7 SASI_Hs02_00350138 predicted 747
8 SASI_Hs01_00067992 predicted 390
9 SASI_Hs02_00350139 predicted 253
10 SASI_Hs02_00350140 predicted 475
11 SASI_Hs01_00067986 predicted 262
12 SASI_Hs01_00067989 predicted 388
13 SASI_Hs01_00067990 predicted 346
14 SASI_Hs01_00067991 predicted 445
15 SASI_Hs01_00067993 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247105 predicted 487
2 SASI_Hs01_00247106 predicted 443
3 SASI_Hs01_00247107 predicted 259
4 SASI_Hs01_00247108 predicted 342
5 SASI_Hs01_00247109 predicted 271
6 SASI_Hs01_00247110 predicted 394
7 SASI_Hs01_00247111 predicted 347
8 SASI_Hs01_00247112 predicted 438
9 SASI_Hs01_00247113 predicted 394
10 SASI_Hs01_00247114 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373737 predicted 764
2 SASI_Hs02_00373738 predicted 771
3 SASI_Hs01_00045948 predicted 486
4 SASI_Hs01_00045949 predicted 438
5 SASI_Hs01_00045951 predicted 341
6 SASI_Hs01_00045952 predicted 268
7 SASI_Hs02_00373739 predicted 752
8 SASI_Hs01_00045956 predicted 387
9 SASI_Hs02_00373740 predicted 250
10 SASI_Hs02_00373741 predicted 470
11 SASI_Hs01_00045950 predicted 256
12 SASI_Hs01_00045953 predicted 389
13 SASI_Hs01_00045954 predicted 344
14 SASI_Hs01_00045955 predicted 445
15 SASI_Hs01_00045957 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251232 predicted 601
2 SASI_Rn02_00251233 predicted 529
3 SASI_Rn02_00251234 predicted 916
4 SASI_Rn02_00251235 predicted 326
5 SASI_Rn02_00251236 predicted 878
6 SASI_Rn02_00251237 predicted 793
7 SASI_Rn02_00251238 predicted 198
8 SASI_Rn02_00251239 predicted 719
9 SASI_Rn02_00251240 predicted 560
10 SASI_Rn02_00251241 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068395 predicted 1021
2 SASI_Mm01_00068396 predicted 201
3 SASI_Mm01_00068398 predicted 1005
4 SASI_Mm02_00334154 predicted 1027
5 SASI_Mm01_00068399 predicted 211
6 SASI_Mm01_00068400 predicted 1024
7 SASI_Mm01_00068401 predicted 207
8 SASI_Mm01_00068402 predicted 1026
9 SASI_Mm01_00068403 predicted 989
10 SASI_Mm01_00068404 predicted 210
11 SASI_Mm01_00068397 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035935 predicted 767
2 SASI_Mm01_00035936 predicted 673
3 SASI_Mm01_00035937 predicted 745
4 SASI_Mm01_00035938 predicted 658
5 SASI_Mm01_00035939 predicted 760
6 SASI_Mm02_00351876 predicted 738
7 SASI_Mm02_00351877 predicted 680
8 SASI_Mm01_00035940 predicted 764
9 SASI_Mm01_00035942 predicted 763
10 SASI_Mm01_00035943 predicted 645
11 SASI_Mm01_00035941 predicted 759
12 SASI_Mm01_00035944 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017518
VALIDATED
HAUS7 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-170s21c1
Sequence:CCGGCGGGAAGCTGAAGGACCTAAACTCGAGTTTAGGTCCTTCAGCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1121s21c1
Sequence:CCGGTACCAAGATGAATGAACTAATCTCGAGATTAGTTCATTCATCTTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1159s21c1
Sequence:CCGGTCAGTGATGGCCTACGCCAAACTCGAGTTTGGCGTAGGCCATCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-766s21c1
Sequence:CCGGCGCTTAGAACGGAGTACTTTGCTCGAGCAAAGTACTCCGTTCTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-861s21c1
Sequence:CCGGTCCGACTTCCACCAGCTAATCCTCGAGGATTAGCTGGTGGAAGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017518
VALIDATED
HAUS7 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-170s21c1
Sequence:CCGGCGGGAAGCTGAAGGACCTAAACTCGAGTTTAGGTCCTTCAGCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1121s21c1
Sequence:CCGGTACCAAGATGAATGAACTAATCTCGAGATTAGTTCATTCATCTTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1159s21c1
Sequence:CCGGTCAGTGATGGCCTACGCCAAACTCGAGTTTGGCGTAGGCCATCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-766s21c1
Sequence:CCGGCGCTTAGAACGGAGTACTTTGCTCGAGCAAAGTACTCCGTTCTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-861s21c1
Sequence:CCGGTCCGACTTCCACCAGCTAATCCTCGAGGATTAGCTGGTGGAAGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017518
VALIDATED
HAUS7 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-170s21c1
Sequence:CCGGCGGGAAGCTGAAGGACCTAAACTCGAGTTTAGGTCCTTCAGCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1121s21c1
Sequence:CCGGTACCAAGATGAATGAACTAATCTCGAGATTAGTTCATTCATCTTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017518.5-1159s21c1
Sequence:CCGGTCAGTGATGGCCTACGCCAAACTCGAGTTTGGCGTAGGCCATCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-766s21c1
Sequence:CCGGCGCTTAGAACGGAGTACTTTGCTCGAGCAAAGTACTCCGTTCTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017518.5-861s21c1
Sequence:CCGGTCCGACTTCCACCAGCTAATCCTCGAGGATTAGCTGGTGGAAGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207106
HAUS7 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 7
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000183196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207106.2-1001s1c1
Sequence:CCGGGCTACCAAGATGAATGAACTACTCGAGTAGTTCATTCATCTTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207106
HAUS7 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 7
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000183196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207106.2-1001s1c1
Sequence:CCGGGCTACCAAGATGAATGAACTACTCGAGTAGTTCATTCATCTTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207106
HAUS7 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 7
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000183196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207106.2-1001s1c1
Sequence:CCGGGCTACCAAGATGAATGAACTACTCGAGTAGTTCATTCATCTTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028633
VALIDATED
HAUS7 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-462s21c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-121s21c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-121s1c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-462s1c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-1114s1c1
Sequence:CCGGGCTGCCAGAATTGATGAAGTACTCGAGTACTTCATCAATTCTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-786s1c1
Sequence:CCGGCCAGTGCTTTGCACAGCATAACTCGAGTTATGCTGTGCAAAGCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-418s1c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-672s1c1
Sequence:CCGGGCAATCTGATGACCTGCCAAACTCGAGTTTGGCAGGTCATCAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-878s21c1
Sequence:CCGGTGGCCTTCCTGCAAGTCTATGCTCGAGCATAGACTTGCAGGAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-418s21c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028633
VALIDATED
HAUS7 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-462s21c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-121s21c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-121s1c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-462s1c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-1114s1c1
Sequence:CCGGGCTGCCAGAATTGATGAAGTACTCGAGTACTTCATCAATTCTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-786s1c1
Sequence:CCGGCCAGTGCTTTGCACAGCATAACTCGAGTTATGCTGTGCAAAGCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-418s1c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-672s1c1
Sequence:CCGGGCAATCTGATGACCTGCCAAACTCGAGTTTGGCAGGTCATCAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-878s21c1
Sequence:CCGGTGGCCTTCCTGCAAGTCTATGCTCGAGCATAGACTTGCAGGAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-418s21c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028633
VALIDATED
HAUS7 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-462s21c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-121s21c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-121s1c1
Sequence:CCGGGATGACAGCTACTACAAAGATCTCGAGATCTTTGTAGTAGCTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-462s1c1
Sequence:CCGGGCAACTACAGTTCATGGACAACTCGAGTTGTCCATGAACTGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028633.1-1114s1c1
Sequence:CCGGGCTGCCAGAATTGATGAAGTACTCGAGTACTTCATCAATTCTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-786s1c1
Sequence:CCGGCCAGTGCTTTGCACAGCATAACTCGAGTTATGCTGTGCAAAGCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-418s1c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028633.1-672s1c1
Sequence:CCGGGCAATCTGATGACCTGCCAAACTCGAGTTTGGCAGGTCATCAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-878s21c1
Sequence:CCGGTGGCCTTCCTGCAAGTCTATGCTCGAGCATAGACTTGCAGGAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028633.3-418s21c1
Sequence:CCGGCCAGATGACCAGGATCTTCTACTCGAGTAGAAGATCCTGGTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)