EMAIL THIS PAGE TO A FRIEND

HAVCR1

hepatitis A virus cellular receptor 1

99 Gene Product Result for
Synonyms: HAVCR HAVCR-1 KIM-1 KIM1 TIM TIM-1 TIM1 TIMD-1 TIMD1
UniProtKB ID: Q96D42, O43656
Gene ID:
Human(26762) Summary: The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(171283) hepatitis A virus cellular receptor 1
Rat(286934) hepatitis A virus cellular receptor 1
Zebrafish(436707) hepatitis A virus cellular receptor 1
cow(614846) hepatitis A virus cellular receptor 1
cow(613999) hepatitis A virus cellular receptor 1
domestic cat(101099778) hepatitis A virus cellular receptor 1
dog(612069) hepatitis A virus cellular receptor 1
chicken(416249) hepatitis A virus cellular receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099414 Rosetta Predictions human pricing
NM_012206 Rosetta Predictions human pricing
NM_173149 Rosetta Predictions rat pricing
NM_134248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320669 predicted 1019
2 SASI_Hs02_00320670 predicted 1012
3 SASI_Hs02_00320671 predicted 941
4 SASI_Hs02_00320672 predicted 1037
5 SASI_Hs02_00320673 predicted 1171
6 SASI_Hs02_00320674 predicted 1163
7 SASI_Hs02_00320675 predicted 1047
8 SASI_Hs02_00320676 predicted 667
9 SASI_Hs02_00320677 predicted 1155
10 SASI_Hs02_00320678 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012694 predicted 1368
2 SASI_Hs01_00012695 predicted 1364
3 SASI_Hs02_00343861 predicted 1283
4 SASI_Hs01_00012696 predicted 1383
5 SASI_Hs01_00012698 predicted 1518
6 SASI_Hs01_00012699 predicted 1508
7 SASI_Hs02_00343862 predicted 1397
8 SASI_Hs02_00343863 predicted 1013
9 SASI_Hs01_00012703 predicted 1499
10 SASI_Hs02_00343864 predicted 1428
11 SASI_Hs01_00012697 predicted 850
12 SASI_Hs01_00012700 predicted 883
13 SASI_Hs01_00012701 predicted 1180
14 SASI_Hs01_00012702 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042322 predicted 758
2 SASI_Rn01_00042323 predicted 999
3 SASI_Rn01_00042324 predicted 1242
4 SASI_Rn01_00042325 predicted 969
5 SASI_Rn01_00042326 predicted 789
6 SASI_Rn01_00042327 predicted 1404
7 SASI_Rn01_00042328 predicted 882
8 SASI_Rn01_00042329 predicted 1131
9 SASI_Rn01_00042330 predicted 866
10 SASI_Rn01_00042331 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339541 predicted 518
2 SASI_Mm01_00120525 predicted 299
3 SASI_Mm01_00120527 predicted 200
4 SASI_Mm01_00120529 predicted 525
5 SASI_Mm01_00120530 predicted 264
6 SASI_Mm01_00120532 predicted 613
7 SASI_Mm01_00120533 predicted 697
8 SASI_Mm02_00339542 predicted 577
9 SASI_Mm02_00339543 predicted 595
10 SASI_Mm01_00120534 predicted 413
11 SASI_Mm01_00120526 predicted 630
12 SASI_Mm01_00120528 predicted 411
13 SASI_Mm01_00120531 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134248
HAVCR1 MISSION shRNA Bacterial Glycerol Stock
hepatitis A virus cellular receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-106s1c1
Sequence:CCGGCCATGTACTTACTCAACATATCTCGAGATATGTTGAGTAAGTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-639s1c1
Sequence:CCGGCTCAGGAGATACCTGGAGTAACTCGAGTTACTCCAGGTATCTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-329s1c1
Sequence:CCGGTGGAGATTCCTGGATGGTTTACTCGAGTAAACCATCCAGGAATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-55s1c1
Sequence:CCGGGTGGATTCTTATGTGGAAGTACTCGAGTACTTCCACATAAGAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-640s1c1
Sequence:CCGGTCAGGAGATACCTGGAGTAATCTCGAGATTACTCCAGGTATCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134248
HAVCR1 MISSION shRNA shRNA Plasmid DNA
hepatitis A virus cellular receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-106s1c1
Sequence:CCGGCCATGTACTTACTCAACATATCTCGAGATATGTTGAGTAAGTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-639s1c1
Sequence:CCGGCTCAGGAGATACCTGGAGTAACTCGAGTTACTCCAGGTATCTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-329s1c1
Sequence:CCGGTGGAGATTCCTGGATGGTTTACTCGAGTAAACCATCCAGGAATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-55s1c1
Sequence:CCGGGTGGATTCTTATGTGGAAGTACTCGAGTACTTCCACATAAGAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-640s1c1
Sequence:CCGGTCAGGAGATACCTGGAGTAATCTCGAGATTACTCCAGGTATCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134248
HAVCR1 MISSION shRNA Lentiviral Transduction Particles
hepatitis A virus cellular receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-106s1c1
Sequence:CCGGCCATGTACTTACTCAACATATCTCGAGATATGTTGAGTAAGTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-639s1c1
Sequence:CCGGCTCAGGAGATACCTGGAGTAACTCGAGTTACTCCAGGTATCTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-329s1c1
Sequence:CCGGTGGAGATTCCTGGATGGTTTACTCGAGTAAACCATCCAGGAATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-55s1c1
Sequence:CCGGGTGGATTCTTATGTGGAAGTACTCGAGTACTTCCACATAAGAATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134248.1-640s1c1
Sequence:CCGGTCAGGAGATACCTGGAGTAATCTCGAGATTACTCCAGGTATCTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012206
VALIDATED
HAVCR1 MISSION shRNA Bacterial Glycerol Stock
hepatitis A virus cellular receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-851s1c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-1034s1c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012206.1-206s1c1
Sequence:CCGGGTTCTCTATTCACATGCCAAACTCGAGTTTGGCATGTGAATAGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-902s1c1
Sequence:CCGGCGGCCAATACCACTAAAGGAACTCGAGTTCCTTTAGTGGTATTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-572s1c1
Sequence:CCGGCGACGACAATGACTGTTTCAACTCGAGTTGAAACAGTCATTGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1348s21c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1252s21c1
Sequence:CCGGCGACACTGCAGGGAGCAATAACTCGAGTTATTGCTCCCTGCAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1666s21c1
Sequence:CCGGTGCAGAAGACTGAACAGACATCTCGAGATGTCTGTTCAGTCTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1531s21c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1059s21c1
Sequence:CCGGACGACTGTTCTGACGACAATGCTCGAGCATTGTCGTCAGAACAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012206
VALIDATED
HAVCR1 MISSION shRNA shRNA Plasmid DNA
hepatitis A virus cellular receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-851s1c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-1034s1c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012206.1-206s1c1
Sequence:CCGGGTTCTCTATTCACATGCCAAACTCGAGTTTGGCATGTGAATAGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-902s1c1
Sequence:CCGGCGGCCAATACCACTAAAGGAACTCGAGTTCCTTTAGTGGTATTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-572s1c1
Sequence:CCGGCGACGACAATGACTGTTTCAACTCGAGTTGAAACAGTCATTGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1348s21c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1252s21c1
Sequence:CCGGCGACACTGCAGGGAGCAATAACTCGAGTTATTGCTCCCTGCAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1666s21c1
Sequence:CCGGTGCAGAAGACTGAACAGACATCTCGAGATGTCTGTTCAGTCTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1531s21c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1059s21c1
Sequence:CCGGACGACTGTTCTGACGACAATGCTCGAGCATTGTCGTCAGAACAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012206
VALIDATED
HAVCR1 MISSION shRNA Lentiviral Transduction Particles
hepatitis A virus cellular receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-851s1c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-1034s1c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012206.1-206s1c1
Sequence:CCGGGTTCTCTATTCACATGCCAAACTCGAGTTTGGCATGTGAATAGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-902s1c1
Sequence:CCGGCGGCCAATACCACTAAAGGAACTCGAGTTCCTTTAGTGGTATTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012206.1-572s1c1
Sequence:CCGGCGACGACAATGACTGTTTCAACTCGAGTTGAAACAGTCATTGTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1348s21c1
Sequence:CCGGGCCTTTGGAATAACAATCAAACTCGAGTTTGATTGTTATTCCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1252s21c1
Sequence:CCGGCGACACTGCAGGGAGCAATAACTCGAGTTATTGCTCCCTGCAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1666s21c1
Sequence:CCGGTGCAGAAGACTGAACAGACATCTCGAGATGTCTGTTCAGTCTTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1531s21c1
Sequence:CCGGGCAGCCTTCAAATTAAAGCTTCTCGAGAAGCTTTAATTTGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012206.2-1059s21c1
Sequence:CCGGACGACTGTTCTGACGACAATGCTCGAGCATTGTCGTCAGAACAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)