EMAIL THIS PAGE TO A FRIEND

HAVCR2

hepatitis A virus cellular receptor 2

109 Gene Product Result for
Synonyms: HAVcr-2 KIM-3 TIM3 TIMD-3 TIMD3 Tim-3
UniProtKB ID: Q8TDQ0, B2RAY2, Q8WW60, Q96K94
Gene ID:
Human(84868) Summary: The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011]
Mouse(171285) hepatitis A virus cellular receptor 2
Rat(363578) hepatitis A virus cellular receptor 2
dog(479318) hepatitis A virus cellular receptor 2
domestic cat(101089981) hepatitis A virus cellular receptor 2
cow(768047) hepatitis A virus cellular receptor 2
sheep(101112135) hepatitis A virus cellular receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037081 MISSION® esiRNA esiRNA human HAVCR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032782 Rosetta Predictions human pricing
NM_001100762 Rosetta Predictions rat pricing
NM_134250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114252 predicted 645
2 SASI_Hs01_00114253 predicted 788
3 SASI_Hs01_00114254 predicted 473
4 SASI_Hs01_00114255 predicted 1036
5 SASI_Hs01_00114257 predicted 787
6 SASI_Hs01_00114258 predicted 1016
7 SASI_Hs01_00114259 predicted 972
8 SASI_Hs01_00114260 predicted 938
9 SASI_Hs01_00114261 predicted 236
10 SASI_Hs02_00360335 predicted 932
11 SASI_Hs01_00114256 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210498 predicted 1080
2 SASI_Rn02_00210499 predicted 1061
3 SASI_Rn02_00210500 predicted 1089
4 SASI_Rn02_00210501 predicted 1203
5 SASI_Rn02_00210502 predicted 710
6 SASI_Rn02_00210503 predicted 1196
7 SASI_Rn02_00210504 predicted 285
8 SASI_Rn02_00210505 predicted 873
9 SASI_Rn02_00210506 predicted 744
10 SASI_Rn02_00210507 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040231 predicted 684
2 SASI_Mm01_00040232 predicted 683
3 SASI_Mm01_00040233 predicted 755
4 SASI_Mm01_00040234 predicted 704
5 SASI_Mm01_00040235 predicted 869
6 SASI_Mm02_00339554 predicted 267
7 SASI_Mm01_00040237 predicted 626
8 SASI_Mm01_00040238 predicted 701
9 SASI_Mm01_00040239 predicted 312
10 SASI_Mm02_00339555 predicted 802
11 SASI_Mm01_00040230 predicted 340
12 SASI_Mm01_00040236 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032782
HAVCR2 MISSION shRNA Bacterial Glycerol Stock
hepatitis A virus cellular receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-2065s1c1
Sequence:CCGGCGTGGACCAAACTGAAGCTATCTCGAGATAGCTTCAGTTTGGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-896s1c1
Sequence:CCGGCAAATGCAGTAGCAGAGGGAACTCGAGTTCCCTCTGCTACTGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-346s1c1
Sequence:CCGGCTCAGGACTGATGAAAGGGATCTCGAGATCCCTTTCATCAGTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-683s1c1
Sequence:CCGGCCAATGAGTTACGGGACTCTACTCGAGTAGAGTCCCGTAACTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-1028s1c1
Sequence:CCGGGTTGTCGCTTTGCAATGCCATCTCGAGATGGCATTGCAAAGCGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-1022s1c1
Sequence:CCGGCTTTGGGTTGTCGCTTTGCAACTCGAGTTGCAAAGCGACAACCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-1207s1c1
Sequence:CCGGGCACTGAACTTAAACAGGCATCTCGAGATGCCTGTTTAAGTTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032782
HAVCR2 MISSION shRNA shRNA Plasmid DNA
hepatitis A virus cellular receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-2065s1c1
Sequence:CCGGCGTGGACCAAACTGAAGCTATCTCGAGATAGCTTCAGTTTGGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-896s1c1
Sequence:CCGGCAAATGCAGTAGCAGAGGGAACTCGAGTTCCCTCTGCTACTGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-346s1c1
Sequence:CCGGCTCAGGACTGATGAAAGGGATCTCGAGATCCCTTTCATCAGTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-683s1c1
Sequence:CCGGCCAATGAGTTACGGGACTCTACTCGAGTAGAGTCCCGTAACTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-1028s1c1
Sequence:CCGGGTTGTCGCTTTGCAATGCCATCTCGAGATGGCATTGCAAAGCGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-1022s1c1
Sequence:CCGGCTTTGGGTTGTCGCTTTGCAACTCGAGTTGCAAAGCGACAACCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-1207s1c1
Sequence:CCGGGCACTGAACTTAAACAGGCATCTCGAGATGCCTGTTTAAGTTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032782
HAVCR2 MISSION shRNA Lentiviral Transduction Particles
hepatitis A virus cellular receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-2065s1c1
Sequence:CCGGCGTGGACCAAACTGAAGCTATCTCGAGATAGCTTCAGTTTGGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-896s1c1
Sequence:CCGGCAAATGCAGTAGCAGAGGGAACTCGAGTTCCCTCTGCTACTGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-346s1c1
Sequence:CCGGCTCAGGACTGATGAAAGGGATCTCGAGATCCCTTTCATCAGTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-683s1c1
Sequence:CCGGCCAATGAGTTACGGGACTCTACTCGAGTAGAGTCCCGTAACTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032782.3-1028s1c1
Sequence:CCGGGTTGTCGCTTTGCAATGCCATCTCGAGATGGCATTGCAAAGCGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032782.3-1022s1c1
Sequence:CCGGCTTTGGGTTGTCGCTTTGCAACTCGAGTTGCAAAGCGACAACCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032782.3-1207s1c1
Sequence:CCGGGCACTGAACTTAAACAGGCATCTCGAGATGCCTGTTTAAGTTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134250
HAVCR2 MISSION shRNA Bacterial Glycerol Stock
hepatitis A virus cellular receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134250.1-2364s1c1
Sequence:CCGGCCCATCTATAACAGAATCAAACTCGAGTTTGATTCTGTTATAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-708s1c1
Sequence:CCGGCCTTAAATGGTATTCCTGTAACTCGAGTTACAGGAATACCATTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-136s1c1
Sequence:CCGGGATGGTTATAAGGTTGAGGTTCTCGAGAACCTCAACCTTATAACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-179s1c1
Sequence:CCGGGCAGTTACACTCTACCTACATCTCGAGATGTAGGTAGAGTGTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-411s1c1
Sequence:CCGGCCCTGGTCTTATGAATGATAACTCGAGTTATCATTCATAAGACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134250
HAVCR2 MISSION shRNA shRNA Plasmid DNA
hepatitis A virus cellular receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134250.1-2364s1c1
Sequence:CCGGCCCATCTATAACAGAATCAAACTCGAGTTTGATTCTGTTATAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-708s1c1
Sequence:CCGGCCTTAAATGGTATTCCTGTAACTCGAGTTACAGGAATACCATTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-136s1c1
Sequence:CCGGGATGGTTATAAGGTTGAGGTTCTCGAGAACCTCAACCTTATAACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-179s1c1
Sequence:CCGGGCAGTTACACTCTACCTACATCTCGAGATGTAGGTAGAGTGTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-411s1c1
Sequence:CCGGCCCTGGTCTTATGAATGATAACTCGAGTTATCATTCATAAGACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134250
HAVCR2 MISSION shRNA Lentiviral Transduction Particles
hepatitis A virus cellular receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134250.1-2364s1c1
Sequence:CCGGCCCATCTATAACAGAATCAAACTCGAGTTTGATTCTGTTATAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-708s1c1
Sequence:CCGGCCTTAAATGGTATTCCTGTAACTCGAGTTACAGGAATACCATTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-136s1c1
Sequence:CCGGGATGGTTATAAGGTTGAGGTTCTCGAGAACCTCAACCTTATAACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-179s1c1
Sequence:CCGGGCAGTTACACTCTACCTACATCTCGAGATGTAGGTAGAGTGTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134250.1-411s1c1
Sequence:CCGGCCCTGGTCTTATGAATGATAACTCGAGTTATCATTCATAAGACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)