EMAIL THIS PAGE TO A FRIEND

HAX1

HCLS1 associated protein X-1

87 Gene Product Result for
Synonyms: HCLSBP1 HS1BP1 SCN3
Gene ID:
Human(10456) Summary: The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(23897) HCLS1 associated X-1
Rat(291202) HCLS1 associated protein X-1
domestic guinea pig(100731401) HCLS1 associated protein X-1
naked mole-rat(101726528) HCLS1 associated protein X-1
sheep(101111760) HCLS1 associated protein X-1
Zebrafish(436609) HCLS1 associated protein X-1
cow(506895) HCLS1 associated protein X-1
domestic cat(101097787) HCLS1 associated protein X-1
dog(480134) HCLS1 associated protein X-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500504 Anti-HAX1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2103458 Anti-HAX1 antibody produced in rabbit affinity isolated antibody bovine, mouse, horse, guinea pig, canine, human, rat
immunohistochemistry, western blot pricing
HPA055141 Anti-HAX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA075289 Anti-HAX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
PRS4711 Anti-Hax1a antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
PRS4715 Anti-Hax1b antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
WH0010456M1 Monoclonal Anti-HAX1 antibody produced in mouse clone 2G12, ascites fluid human
ELISA pricing
SAB1404830 Monoclonal Anti-HAX1 antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB3500475 Monoclonal Anti-Hax1a antibody produced in mouse clone 8F9G7, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB3500476 Monoclonal Anti-Hax1a antibody produced in mouse clone 9G3D11, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB3500477 Monoclonal Anti-Hax1a antibody produced in mouse clone 9G6C6, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105771 MISSION® esiRNA esiRNA human HAX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018837 Rosetta Predictions human pricing
NM_006118 Rosetta Predictions human pricing
NM_181627 Rosetta Predictions rat pricing
NM_011826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083437 predicted 565
2 SASI_Hs02_00307051 predicted 505
3 SASI_Hs01_00083438 predicted 572
4 SASI_Hs02_00307052 predicted 640
5 SASI_Hs01_00083439 predicted 590
6 SASI_Hs02_00307053 predicted 594
7 SASI_Hs01_00083441 predicted 504
8 SASI_Hs01_00083443 predicted 649
9 SASI_Hs01_00083444 predicted 655
10 SASI_Hs02_00307054 predicted 590
11 SASI_Hs01_00083435 predicted 452
12 SASI_Hs01_00083436 predicted 563
13 SASI_Hs01_00083440 predicted 549
14 SASI_Hs01_00083442 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125173 predicted 707
2 SASI_Hs02_00340938 predicted 647
3 SASI_Hs01_00125174 predicted 714
4 SASI_Hs02_00340939 predicted 788
5 SASI_Hs01_00125175 predicted 734
6 SASI_Hs02_00340940 predicted 737
7 SASI_Hs01_00125177 predicted 644
8 SASI_Hs01_00125179 predicted 789
9 SASI_Hs01_00125180 predicted 807
10 SASI_Hs02_00340941 predicted 734
11 SASI_Hs01_00125171 predicted 591
12 SASI_Hs01_00125172 predicted 707
13 SASI_Hs01_00125176 predicted 691
14 SASI_Hs01_00125178 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118294 predicted 486
2 SASI_Rn01_00118295 predicted 279
3 SASI_Rn02_00269762 predicted 295
4 SASI_Rn01_00118296 predicted 289
5 SASI_Rn01_00118297 predicted 693
6 SASI_Rn01_00118300 predicted 691
7 SASI_Rn01_00118301 predicted 705
8 SASI_Rn02_00269763 predicted 235
9 SASI_Rn01_00118302 predicted 426
10 SASI_Rn01_00118303 predicted 598
11 SASI_Rn01_00118298 predicted 216
12 SASI_Rn01_00118299 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321536 predicted 529
2 SASI_Mm01_00047311 predicted 479
3 SASI_Mm01_00047312 predicted 660
4 SASI_Mm01_00047313 predicted 739
5 SASI_Mm02_00321537 predicted 480
6 SASI_Mm02_00321538 predicted 687
7 SASI_Mm01_00047317 predicted 499
8 SASI_Mm01_00047318 predicted 863
9 SASI_Mm01_00047319 predicted 506
10 SASI_Mm02_00321539 predicted 489
11 SASI_Mm01_00047310 predicted 548
12 SASI_Mm01_00047314 predicted 722
13 SASI_Mm01_00047315 predicted 754
14 SASI_Mm01_00047316 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006118
HAX1 MISSION shRNA Bacterial Glycerol Stock
HCLS1 associated protein X-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-767s1c1
Sequence:CCGGCCAGCCCAAATCCTATTTCAACTCGAGTTGAAATAGGATTTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-964s1c1
Sequence:CCGGTGGACTTATTCCTGGGACGTTCTCGAGAACGTCCCAGGAATAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-647s1c1
Sequence:CCGGCCAGAGGCCATTTCATAGGTTCTCGAGAACCTATGAAATGGCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-527s1c1
Sequence:CCGGACAGACACTTCGGGACTCAATCTCGAGATTGAGTCCCGAAGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-243s1c1
Sequence:CCGGACTCGAGATGAAGATGATGATCTCGAGATCATCATCTTCATCTCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006118
HAX1 MISSION shRNA shRNA Plasmid DNA
HCLS1 associated protein X-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-767s1c1
Sequence:CCGGCCAGCCCAAATCCTATTTCAACTCGAGTTGAAATAGGATTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-964s1c1
Sequence:CCGGTGGACTTATTCCTGGGACGTTCTCGAGAACGTCCCAGGAATAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-647s1c1
Sequence:CCGGCCAGAGGCCATTTCATAGGTTCTCGAGAACCTATGAAATGGCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-527s1c1
Sequence:CCGGACAGACACTTCGGGACTCAATCTCGAGATTGAGTCCCGAAGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-243s1c1
Sequence:CCGGACTCGAGATGAAGATGATGATCTCGAGATCATCATCTTCATCTCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006118
HAX1 MISSION shRNA Lentiviral Transduction Particles
HCLS1 associated protein X-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-767s1c1
Sequence:CCGGCCAGCCCAAATCCTATTTCAACTCGAGTTGAAATAGGATTTGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-964s1c1
Sequence:CCGGTGGACTTATTCCTGGGACGTTCTCGAGAACGTCCCAGGAATAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-647s1c1
Sequence:CCGGCCAGAGGCCATTTCATAGGTTCTCGAGAACCTATGAAATGGCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-527s1c1
Sequence:CCGGACAGACACTTCGGGACTCAATCTCGAGATTGAGTCCCGAAGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006118.2-243s1c1
Sequence:CCGGACTCGAGATGAAGATGATGATCTCGAGATCATCATCTTCATCTCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011826
VALIDATED
HAX1 MISSION shRNA Bacterial Glycerol Stock
HCLS1 associated protein X-1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-717s1c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-339s1c1
Sequence:CCGGCGGCAACTTTGGCTTTGATGACTCGAGTCATCAAAGCCAAAGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-337s1c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-886s1c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-477s1c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-884s21c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-335s21c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-715s21c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-475s21c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011826
VALIDATED
HAX1 MISSION shRNA shRNA Plasmid DNA
HCLS1 associated protein X-1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-717s1c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-339s1c1
Sequence:CCGGCGGCAACTTTGGCTTTGATGACTCGAGTCATCAAAGCCAAAGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-337s1c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-886s1c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-477s1c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-884s21c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-335s21c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-715s21c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-475s21c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011826
VALIDATED
HAX1 MISSION shRNA Lentiviral Transduction Particles
HCLS1 associated protein X-1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-717s1c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-339s1c1
Sequence:CCGGCGGCAACTTTGGCTTTGATGACTCGAGTCATCAAAGCCAAAGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-337s1c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-886s1c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011826.1-477s1c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-884s21c1
Sequence:CCGGTCAGCTTTGGATGATCCCTTTCTCGAGAAAGGGATCATCCAAAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-335s21c1
Sequence:CCGGCACGGCAACTTTGGCTTTGATCTCGAGATCAAAGCCAAAGTTGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-715s21c1
Sequence:CCGGCCAGCCCAAATCGTATTTCAACTCGAGTTGAAATACGATTTGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011826.3-475s21c1
Sequence:CCGGGCAGACACTACGAGACTCAATCTCGAGATTGAGTCTCGTAGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)