EMAIL THIS PAGE TO A FRIEND

HBA1

hemoglobin, alpha 1

40 Gene Product Result for
Synonyms: CD31 HBH
Gene ID:
Human(3039) Summary: The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]
Rat(25632) hemoglobin, alpha 1
cow(100140149) hemoglobin, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500116 Anti-Haemoglobin Alpha Chain antibody, Rabbit monoclonal clone SP212, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
HPA043780 Anti-HBA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1303638 ANTI-HBA2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
WH0003039M2 Monoclonal Anti-HBA1 antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409175 Monoclonal Anti-HBA1 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409176 Monoclonal Anti-HBA1 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409177 Monoclonal Anti-HBA1 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409178 Monoclonal Anti-HBA1 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409179 Monoclonal Anti-HBA1 antibody produced in mouse clone 2A3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409180 Monoclonal Anti-HBA1 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Kits

Product # Description Species Add to Cart
 
MAK115 Hemoglobin Assay Kit sufficient for 250 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000558 Rosetta Predictions human pricing
NM_013096 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026722 predicted 199
2 SASI_Hs01_00026723 predicted 248
3 SASI_Hs01_00026724 predicted 245
4 SASI_Hs01_00026725 predicted 257
5 SASI_Hs01_00026726 predicted 334
6 SASI_Hs01_00026727 predicted 124
7 SASI_Hs01_00026728 predicted 198
8 SASI_Hs01_00026729 predicted 278
9 SASI_Hs01_00026730 predicted 402
10 SASI_Hs01_00026731 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036733 predicted 219
2 SASI_Rn01_00036734 predicted 217
3 SASI_Rn01_00036735 predicted 241
4 SASI_Rn01_00036737 predicted 506
5 SASI_Rn01_00036739 predicted 359
6 SASI_Rn01_00036740 predicted 513
7 SASI_Rn01_00036741 predicted 157
8 SASI_Rn01_00036742 predicted 504
9 SASI_Rn02_00260864 predicted 424
10 SASI_Rn02_00260865 predicted 481
11 SASI_Rn01_00036736 predicted 83
12 SASI_Rn01_00036738 predicted 42
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000558
HBA1 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-211s1c1
Sequence:CCGGCCACGGCAAGAAGGTGGCCGACTCGAGTCGGCCACCTTCTTGCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-424s1c1
Sequence:CCGGCCTGGCTTCTGTGAGCACCGTCTCGAGACGGTGCTCACAGAAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-334s1c1
Sequence:CCGGCAAGCTCCTAAGCCACTGCCTCTCGAGAGGCAGTGGCTTAGGAGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-199s1c1
Sequence:CCGGCCAGGTTAAGGGCCACGGCAACTCGAGTTGCCGTGGCCCTTAACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-128s21c1
Sequence:CCGGGAGAGGATGTTCCTGTCCTTCCTCGAGGAAGGACAGGAACATCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-149s21c1
Sequence:CCGGCCCACCACCAAGACCTACTTCCTCGAGGAAGTAGGTCTTGGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-327s21c1
Sequence:CCGGTCAACTTCAAGCTCCTAAGCCCTCGAGGGCTTAGGAGCTTGAAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-165s21c1
Sequence:CCGGACTTCCCGCACTTCGACCTGACTCGAGTCAGGTCGAAGTGCGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000558
HBA1 MISSION shRNA shRNA Plasmid DNA
hemoglobin, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-211s1c1
Sequence:CCGGCCACGGCAAGAAGGTGGCCGACTCGAGTCGGCCACCTTCTTGCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-424s1c1
Sequence:CCGGCCTGGCTTCTGTGAGCACCGTCTCGAGACGGTGCTCACAGAAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-334s1c1
Sequence:CCGGCAAGCTCCTAAGCCACTGCCTCTCGAGAGGCAGTGGCTTAGGAGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-199s1c1
Sequence:CCGGCCAGGTTAAGGGCCACGGCAACTCGAGTTGCCGTGGCCCTTAACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-128s21c1
Sequence:CCGGGAGAGGATGTTCCTGTCCTTCCTCGAGGAAGGACAGGAACATCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-149s21c1
Sequence:CCGGCCCACCACCAAGACCTACTTCCTCGAGGAAGTAGGTCTTGGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-327s21c1
Sequence:CCGGTCAACTTCAAGCTCCTAAGCCCTCGAGGGCTTAGGAGCTTGAAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-165s21c1
Sequence:CCGGACTTCCCGCACTTCGACCTGACTCGAGTCAGGTCGAAGTGCGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000558
HBA1 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-211s1c1
Sequence:CCGGCCACGGCAAGAAGGTGGCCGACTCGAGTCGGCCACCTTCTTGCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-424s1c1
Sequence:CCGGCCTGGCTTCTGTGAGCACCGTCTCGAGACGGTGCTCACAGAAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-334s1c1
Sequence:CCGGCAAGCTCCTAAGCCACTGCCTCTCGAGAGGCAGTGGCTTAGGAGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000558.3-199s1c1
Sequence:CCGGCCAGGTTAAGGGCCACGGCAACTCGAGTTGCCGTGGCCCTTAACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-128s21c1
Sequence:CCGGGAGAGGATGTTCCTGTCCTTCCTCGAGGAAGGACAGGAACATCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-149s21c1
Sequence:CCGGCCCACCACCAAGACCTACTTCCTCGAGGAAGTAGGTCTTGGTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-327s21c1
Sequence:CCGGTCAACTTCAAGCTCCTAAGCCCTCGAGGGCTTAGGAGCTTGAAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000558.3-165s21c1
Sequence:CCGGACTTCCCGCACTTCGACCTGACTCGAGTCAGGTCGAAGTGCGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)