EMAIL THIS PAGE TO A FRIEND

HBA2

hemoglobin, alpha 2

36 Gene Product Result for
Synonyms: HBH
Gene ID:
Human(3040) Summary: The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]
Rat(360504) hemoglobin, alpha 2
Horse(100036558) hemoglobin, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500116 Anti-Haemoglobin Alpha Chain antibody, Rabbit monoclonal clone SP212, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
B7273 Bezafibrate ≥98%, solid human, mouse pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
560510 3-(Diethylamino)propyl isothiocyanate 97% human pricing

Kits

Product # Description Species Add to Cart
 
MAK115 Hemoglobin Assay Kit sufficient for 250 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000517 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146971 MISSION® esiRNA esiRNA human HBA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000517 Rosetta Predictions human pricing
NM_001007722 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302708 predicted 497
2 SASI_Hs01_00099243 predicted 569
3 SASI_Hs01_00099236 predicted 341
4 SASI_Hs01_00099237 predicted 275
5 SASI_Hs01_00099238 predicted 293
6 SASI_Hs01_00099239 predicted 244
7 SASI_Hs01_00099240 predicted 300
8 SASI_Hs01_00099241 predicted 250
9 SASI_Hs01_00099242 predicted 309
10 SASI_Hs01_00099244 predicted 195
11 SASI_Hs01_00099245 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086673 predicted 237
2 SASI_Rn01_00086674 predicted 459
3 SASI_Rn01_00086675 predicted 516
4 SASI_Rn01_00086676 predicted 505
5 SASI_Rn01_00086677 predicted 505
6 SASI_Rn01_00086678 predicted 502
7 SASI_Rn01_00086680 predicted 34
8 SASI_Rn01_00086681 predicted 509
9 SASI_Rn02_00198905 predicted 153
10 SASI_Rn01_00086679 predicted 83
11 SASI_Rn01_00086672 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000517
HBA2 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-156s21c1
Sequence:CCGGGGAGAGGATGTTCCTGTCCTTCTCGAGAAGGACAGGAACATCCTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-451s21c1
Sequence:CCGGTTCCTGGCTTCTGTGAGCACCCTCGAGGGTGCTCACAGAAGCCAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-230s21c1
Sequence:CCGGAGGTTAAGGGCCACGGCAAGACTCGAGTCTTGCCGTGGCCCTTAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-324s1c1
Sequence:CCGGCGGTCAACTTCAAGCTCCTAACTCGAGTTAGGAGCTTGAAGTTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-411s1c1
Sequence:CCGGCCCTGGACAAGTTCCTGGCTTCTCGAGAAGCCAGGAACTTGTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-157s1c1
Sequence:CCGGCAAGACCTACTTCCCGCACTTCTCGAGAAGTGCGGGAAGTAGGTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-323s1c1
Sequence:CCGGCCGGTCAACTTCAAGCTCCTACTCGAGTAGGAGCTTGAAGTTGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-186s1c1
Sequence:CCGGGCCACGGCTCTGCCCAGGTTACTCGAGTAACCTGGGCAGAGCCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000517
HBA2 MISSION shRNA shRNA Plasmid DNA
hemoglobin, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-156s21c1
Sequence:CCGGGGAGAGGATGTTCCTGTCCTTCTCGAGAAGGACAGGAACATCCTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-451s21c1
Sequence:CCGGTTCCTGGCTTCTGTGAGCACCCTCGAGGGTGCTCACAGAAGCCAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-230s21c1
Sequence:CCGGAGGTTAAGGGCCACGGCAAGACTCGAGTCTTGCCGTGGCCCTTAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-324s1c1
Sequence:CCGGCGGTCAACTTCAAGCTCCTAACTCGAGTTAGGAGCTTGAAGTTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-411s1c1
Sequence:CCGGCCCTGGACAAGTTCCTGGCTTCTCGAGAAGCCAGGAACTTGTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-157s1c1
Sequence:CCGGCAAGACCTACTTCCCGCACTTCTCGAGAAGTGCGGGAAGTAGGTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-323s1c1
Sequence:CCGGCCGGTCAACTTCAAGCTCCTACTCGAGTAGGAGCTTGAAGTTGACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-186s1c1
Sequence:CCGGGCCACGGCTCTGCCCAGGTTACTCGAGTAACCTGGGCAGAGCCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000517
HBA2 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-156s21c1
Sequence:CCGGGGAGAGGATGTTCCTGTCCTTCTCGAGAAGGACAGGAACATCCTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-451s21c1
Sequence:CCGGTTCCTGGCTTCTGTGAGCACCCTCGAGGGTGCTCACAGAAGCCAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000517.4-230s21c1
Sequence:CCGGAGGTTAAGGGCCACGGCAAGACTCGAGTCTTGCCGTGGCCCTTAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-324s1c1
Sequence:CCGGCGGTCAACTTCAAGCTCCTAACTCGAGTTAGGAGCTTGAAGTTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-411s1c1
Sequence:CCGGCCCTGGACAAGTTCCTGGCTTCTCGAGAAGCCAGGAACTTGTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-157s1c1
Sequence:CCGGCAAGACCTACTTCCCGCACTTCTCGAGAAGTGCGGGAAGTAGGTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-323s1c1
Sequence:CCGGCCGGTCAACTTCAAGCTCCTACTCGAGTAGGAGCTTGAAGTTGACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000517.3-186s1c1
Sequence:CCGGGCCACGGCTCTGCCCAGGTTACTCGAGTAACCTGGGCAGAGCCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)