EMAIL THIS PAGE TO A FRIEND

HBD

hemoglobin, delta

21 Gene Product Result for
UniProtKB ID: P02042, Q3Y5H3, Q8WXT7
Gene ID:
Human(3045) Summary: The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia. [provided by RefSeq, Jul 2008]
Human(100187828) hypophosphatemic bone disease
dog(476825) hemoglobin, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
H7379 Hemoglobin human lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000519 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096981 MISSION® esiRNA esiRNA human HBD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000519 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189788 predicted 537
2 SASI_Hs01_00189790 predicted 282
3 SASI_Hs01_00189791 predicted 517
4 SASI_Hs01_00189792 predicted 384
5 SASI_Hs01_00189793 predicted 542
6 SASI_Hs01_00189794 predicted 276
7 SASI_Hs01_00189795 predicted 504
8 SASI_Hs01_00189789 predicted 212
9 SASI_Hs01_00189796 predicted 638
10 SASI_Hs01_00189797 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000519
HBD MISSION shRNA Bacterial Glycerol Stock
hemoglobin, delta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-396s1c1
Sequence:CCGGGCCCGCAACTTTGGCAAGGAACTCGAGTTCCTTGCCAAAGTTGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-398s1c1
Sequence:CCGGCCGCAACTTTGGCAAGGAATTCTCGAGAATTCCTTGCCAAAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-247s1c1
Sequence:CCGGAGAAGGTGCTAGGTGCCTTTACTCGAGTAAAGGCACCTAGCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-142s1c1
Sequence:CCGGGATTACTGGTGGTCTACCCTTCTCGAGAAGGGTAGACCACCAGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-134s1c1
Sequence:CCGGCCTGGGCAGATTACTGGTGGTCTCGAGACCACCAGTAATCTGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-314s21c1
Sequence:CCGGAGAGGTTCTTTGAGTCCTTTGCTCGAGCAAAGGACTCAAAGAACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-246s21c1
Sequence:CCGGCAAAGTGAACGTGGATGCAGTCTCGAGACTGCATCCACGTTCACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000519
HBD MISSION shRNA shRNA Plasmid DNA
hemoglobin, delta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-396s1c1
Sequence:CCGGGCCCGCAACTTTGGCAAGGAACTCGAGTTCCTTGCCAAAGTTGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-398s1c1
Sequence:CCGGCCGCAACTTTGGCAAGGAATTCTCGAGAATTCCTTGCCAAAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-247s1c1
Sequence:CCGGAGAAGGTGCTAGGTGCCTTTACTCGAGTAAAGGCACCTAGCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-142s1c1
Sequence:CCGGGATTACTGGTGGTCTACCCTTCTCGAGAAGGGTAGACCACCAGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-134s1c1
Sequence:CCGGCCTGGGCAGATTACTGGTGGTCTCGAGACCACCAGTAATCTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-314s21c1
Sequence:CCGGAGAGGTTCTTTGAGTCCTTTGCTCGAGCAAAGGACTCAAAGAACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-246s21c1
Sequence:CCGGCAAAGTGAACGTGGATGCAGTCTCGAGACTGCATCCACGTTCACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000519
HBD MISSION shRNA Lentiviral Transduction Particles
hemoglobin, delta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-396s1c1
Sequence:CCGGGCCCGCAACTTTGGCAAGGAACTCGAGTTCCTTGCCAAAGTTGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-398s1c1
Sequence:CCGGCCGCAACTTTGGCAAGGAATTCTCGAGAATTCCTTGCCAAAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-247s1c1
Sequence:CCGGAGAAGGTGCTAGGTGCCTTTACTCGAGTAAAGGCACCTAGCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-142s1c1
Sequence:CCGGGATTACTGGTGGTCTACCCTTCTCGAGAAGGGTAGACCACCAGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000519.2-134s1c1
Sequence:CCGGCCTGGGCAGATTACTGGTGGTCTCGAGACCACCAGTAATCTGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-314s21c1
Sequence:CCGGAGAGGTTCTTTGAGTCCTTTGCTCGAGCAAAGGACTCAAAGAACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000519.3-246s21c1
Sequence:CCGGCAAAGTGAACGTGGATGCAGTCTCGAGACTGCATCCACGTTCACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)