EMAIL THIS PAGE TO A FRIEND

HBEGF

heparin-binding EGF-like growth factor

137 Gene Product Result for
Synonyms: DTR DTS DTSF HEGFL
UniProtKB ID: Q99075, B2R821
Gene ID:
Mouse(15200) heparin-binding EGF-like growth factor
Rat(25433) heparin-binding EGF-like growth factor
chicken(395654) heparin-binding EGF-like growth factor
cow(522921) heparin-binding EGF-like growth factor
domestic cat(101093578) heparin-binding EGF-like growth factor
dog(607007) heparin-binding EGF-like growth factor
domestic guinea pig(100731681) heparin-binding EGF-like growth factor
naked mole-rat(101699647) heparin-binding EGF-like growth factor
sheep(101118185) heparin-binding EGF-like growth factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001581 MISSION® esiRNA esiRNA targeting human HBEGF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001945 siRNAs that have been validated in the lab human pricing
NM_012945 Rosetta Predictions rat pricing
NM_010415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001945 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022632 validated 776
2 SASI_Hs01_00022633 predicted 567
3 SASI_Hs01_00022634 predicted 886
4 SASI_Hs01_00022635 predicted 520
5 SASI_Hs01_00022637 predicted 428
6 SASI_Hs01_00022638 predicted 592
7 SASI_Hs02_00332858 predicted 962
8 SASI_Hs01_00022639 predicted 760
9 SASI_Hs02_00332859 predicted 495
10 SASI_Hs02_00332860 predicted 282
11 SASI_Hs01_00022636 predicted 503
12 SASI_Hs01_00022640 predicted 933
13 SASI_Hs01_00022641 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119692 predicted 753
2 SASI_Rn01_00119693 predicted 595
3 SASI_Rn01_00119694 predicted 565
4 SASI_Rn02_00260513 predicted 690
5 SASI_Rn01_00119695 predicted 751
6 SASI_Rn01_00119697 predicted 709
7 SASI_Rn01_00119699 predicted 748
8 SASI_Rn02_00260514 predicted 596
9 SASI_Rn01_00119700 predicted 569
10 SASI_Rn02_00260515 predicted 597
11 SASI_Rn01_00119696 predicted 714
12 SASI_Rn01_00119698 predicted 660
13 SASI_Rn01_00119701 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040652 predicted 794
2 SASI_Mm01_00040653 predicted 1155
3 SASI_Mm02_00318554 predicted 1207
4 SASI_Mm01_00040654 predicted 759
5 SASI_Mm01_00040656 predicted 854
6 SASI_Mm01_00040657 predicted 934
7 SASI_Mm01_00040658 predicted 723
8 SASI_Mm01_00040659 predicted 1289
9 SASI_Mm01_00040660 predicted 684
10 SASI_Mm01_00040661 predicted 282
11 SASI_Mm01_00040655 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001945
HBEGF MISSION shRNA Bacterial Glycerol Stock
heparin-binding EGF-like growth factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001945.2-518s21c1
Sequence:CCGGAGCACTGGCCACACCAAACAACTCGAGTTGTTTGGTGTGGCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1208s21c1
Sequence:CCGGGGATTAGAATGCCGGTTAAATCTCGAGATTTAACCGGCATTCTAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-827s1c1
Sequence:CCGGGAGGAGGTTATGATGTGGAAACTCGAGTTTCCACATCATAACCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-579s1c1
Sequence:CCGGCCCATGTCTTCGGAAATACAACTCGAGTTGTATTTCCGAAGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-858s1c1
Sequence:CCGGAGTGAAGTTGGGCATGACTAACTCGAGTTAGTCATGCCCAACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-477s1c1
Sequence:CCGGGAGAGTCACTTTATCCTCCAACTCGAGTTGGAGGATAAAGTGACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-802s1c1
Sequence:CCGGCTTCTCATGTTTAGGTACCATCTCGAGATGGTACCTAAACATGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1030s21c1
Sequence:CCGGAGGATTGGGCCTCCCATAATTCTCGAGAATTATGGGAGGCCCAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001945
HBEGF MISSION shRNA shRNA Plasmid DNA
heparin-binding EGF-like growth factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001945.2-518s21c1
Sequence:CCGGAGCACTGGCCACACCAAACAACTCGAGTTGTTTGGTGTGGCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1208s21c1
Sequence:CCGGGGATTAGAATGCCGGTTAAATCTCGAGATTTAACCGGCATTCTAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-827s1c1
Sequence:CCGGGAGGAGGTTATGATGTGGAAACTCGAGTTTCCACATCATAACCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-579s1c1
Sequence:CCGGCCCATGTCTTCGGAAATACAACTCGAGTTGTATTTCCGAAGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-858s1c1
Sequence:CCGGAGTGAAGTTGGGCATGACTAACTCGAGTTAGTCATGCCCAACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-477s1c1
Sequence:CCGGGAGAGTCACTTTATCCTCCAACTCGAGTTGGAGGATAAAGTGACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-802s1c1
Sequence:CCGGCTTCTCATGTTTAGGTACCATCTCGAGATGGTACCTAAACATGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1030s21c1
Sequence:CCGGAGGATTGGGCCTCCCATAATTCTCGAGAATTATGGGAGGCCCAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001945
HBEGF MISSION shRNA Lentiviral Transduction Particles
heparin-binding EGF-like growth factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001945.2-518s21c1
Sequence:CCGGAGCACTGGCCACACCAAACAACTCGAGTTGTTTGGTGTGGCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1208s21c1
Sequence:CCGGGGATTAGAATGCCGGTTAAATCTCGAGATTTAACCGGCATTCTAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-827s1c1
Sequence:CCGGGAGGAGGTTATGATGTGGAAACTCGAGTTTCCACATCATAACCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-579s1c1
Sequence:CCGGCCCATGTCTTCGGAAATACAACTCGAGTTGTATTTCCGAAGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-858s1c1
Sequence:CCGGAGTGAAGTTGGGCATGACTAACTCGAGTTAGTCATGCCCAACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-477s1c1
Sequence:CCGGGAGAGTCACTTTATCCTCCAACTCGAGTTGGAGGATAAAGTGACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001945.1-802s1c1
Sequence:CCGGCTTCTCATGTTTAGGTACCATCTCGAGATGGTACCTAAACATGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001945.2-1030s21c1
Sequence:CCGGAGGATTGGGCCTCCCATAATTCTCGAGAATTATGGGAGGCCCAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010415
VALIDATED
HBEGF MISSION shRNA Bacterial Glycerol Stock
heparin-binding EGF-like growth factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-579s21c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-1025s21c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010415.1-641s21c1
Sequence:CCGGTCCGTACTCCCTCTTGCAAATCTCGAGATTTGCAAGAGGGAGTACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-579s1c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-1025s1c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-827s1c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-585s1c1
Sequence:CCGGCCTCAGGAAATACAAGGACTACTCGAGTAGTCCTTGTATTTCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-784s1c1
Sequence:CCGGCTTCTTGTCATCGTGGGACTTCTCGAGAAGTCCCACGATGACAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-827s21c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010415
VALIDATED
HBEGF MISSION shRNA shRNA Plasmid DNA
heparin-binding EGF-like growth factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-579s21c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-1025s21c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010415.1-641s21c1
Sequence:CCGGTCCGTACTCCCTCTTGCAAATCTCGAGATTTGCAAGAGGGAGTACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-579s1c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-1025s1c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-827s1c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-585s1c1
Sequence:CCGGCCTCAGGAAATACAAGGACTACTCGAGTAGTCCTTGTATTTCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-784s1c1
Sequence:CCGGCTTCTTGTCATCGTGGGACTTCTCGAGAAGTCCCACGATGACAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-827s21c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010415
VALIDATED
HBEGF MISSION shRNA Lentiviral Transduction Particles
heparin-binding EGF-like growth factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-579s21c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-1025s21c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010415.1-641s21c1
Sequence:CCGGTCCGTACTCCCTCTTGCAAATCTCGAGATTTGCAAGAGGGAGTACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-579s1c1
Sequence:CCGGCCCATGCCTCAGGAAATACAACTCGAGTTGTATTTCCTGAGGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-1025s1c1
Sequence:CCGGGCCTCCTGTAATTGCTCTGTTCTCGAGAACAGAGCAATTACAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010415.1-827s1c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-585s1c1
Sequence:CCGGCCTCAGGAAATACAAGGACTACTCGAGTAGTCCTTGTATTTCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010415.1-784s1c1
Sequence:CCGGCTTCTTGTCATCGTGGGACTTCTCGAGAAGTCCCACGATGACAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010415.1-827s21c1
Sequence:CCGGGAGGAGGTTATGACTTGGAAACTCGAGTTTCCAAGTCATAACCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)