EMAIL THIS PAGE TO A FRIEND

HBG2

hemoglobin, gamma G

19 Gene Product Result for
Synonyms: TNCY
Gene ID:
Human(3048) Summary: The gamma globin genes (HBG1 and HBG2) are normally expressed in the fetal liver, spleen and bone marrow. Two gamma chains together with two alpha chains constitute fetal hemoglobin (HbF) which is normally replaced by adult hemoglobin (HbA) at birth. In some beta-thalassemias and related conditions, gamma chain production continues into adulthood. The two types of gamma chains differ at residue 136 where glycine is found in the G-gamma product (HBG2) and alanine is found in the A-gamma product (HBG1). The former is predominant at birth. The order of the genes in the beta-globin cluster is: 5'- epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328858) hemoglobin, gamma G
chicken(396485) hemoglobin, gamma G
dog(485256) hemoglobin, gamma G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700069 Anti-HBG2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
H7379 Hemoglobin human lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000184 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055232 predicted 303
2 SASI_Hs01_00055233 predicted 273
3 SASI_Hs01_00055234 predicted 269
4 SASI_Hs01_00055236 predicted 274
5 SASI_Hs01_00055237 predicted 164
6 SASI_Hs01_00055238 predicted 140
7 SASI_Hs01_00055241 predicted 512
8 SASI_Hs01_00055239 predicted 67
9 SASI_Hs01_00055240 predicted 471
10 SASI_Hs02_00302030 predicted 511
11 SASI_Hs01_00055235 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000184
HBG2 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, gamma G
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-322s21c1
Sequence:CCGGGTGAACTGCACTGTGACAAGCCTCGAGGCTTGTCACAGTGCAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-276s1c1
Sequence:CCGGGCCATAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-291s1c1
Sequence:CCGGGATGATCTCAAGGGCACCTTTCTCGAGAAAGGTGCCCTTGAGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-170s1c1
Sequence:CCGGCCAGAGGTTCTTTGACAGCTTCTCGAGAAGCTGTCAAAGAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-399s1c1
Sequence:CCGGGCAATCCATTTCGGCAAAGAACTCGAGTTCTTTGCCGAAATGGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-115s1c1
Sequence:CCGGTGGAAGATGCTGGAGGAGAAACTCGAGTTTCTCCTCCAGCATCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-233s21c1
Sequence:CCGGAGTCAAGGCACATGGCAAGAACTCGAGTTCTTGCCATGTGCCTTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-376s21c1
Sequence:CCGGGAAATGTGCTGGTGACCGTTTCTCGAGAAACGGTCACCAGCACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-348s21c1
Sequence:CCGGGTGGATCCTGAGAACTTCAAGCTCGAGCTTGAAGTTCTCAGGATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000184
HBG2 MISSION shRNA shRNA Plasmid DNA
hemoglobin, gamma G
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-322s21c1
Sequence:CCGGGTGAACTGCACTGTGACAAGCCTCGAGGCTTGTCACAGTGCAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-276s1c1
Sequence:CCGGGCCATAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-291s1c1
Sequence:CCGGGATGATCTCAAGGGCACCTTTCTCGAGAAAGGTGCCCTTGAGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-170s1c1
Sequence:CCGGCCAGAGGTTCTTTGACAGCTTCTCGAGAAGCTGTCAAAGAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-399s1c1
Sequence:CCGGGCAATCCATTTCGGCAAAGAACTCGAGTTCTTTGCCGAAATGGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-115s1c1
Sequence:CCGGTGGAAGATGCTGGAGGAGAAACTCGAGTTTCTCCTCCAGCATCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-233s21c1
Sequence:CCGGAGTCAAGGCACATGGCAAGAACTCGAGTTCTTGCCATGTGCCTTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-376s21c1
Sequence:CCGGGAAATGTGCTGGTGACCGTTTCTCGAGAAACGGTCACCAGCACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-348s21c1
Sequence:CCGGGTGGATCCTGAGAACTTCAAGCTCGAGCTTGAAGTTCTCAGGATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000184
HBG2 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, gamma G
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-322s21c1
Sequence:CCGGGTGAACTGCACTGTGACAAGCCTCGAGGCTTGTCACAGTGCAGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-276s1c1
Sequence:CCGGGCCATAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-291s1c1
Sequence:CCGGGATGATCTCAAGGGCACCTTTCTCGAGAAAGGTGCCCTTGAGATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-170s1c1
Sequence:CCGGCCAGAGGTTCTTTGACAGCTTCTCGAGAAGCTGTCAAAGAACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-399s1c1
Sequence:CCGGGCAATCCATTTCGGCAAAGAACTCGAGTTCTTTGCCGAAATGGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000184.2-115s1c1
Sequence:CCGGTGGAAGATGCTGGAGGAGAAACTCGAGTTTCTCCTCCAGCATCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-233s21c1
Sequence:CCGGAGTCAAGGCACATGGCAAGAACTCGAGTTCTTGCCATGTGCCTTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-376s21c1
Sequence:CCGGGAAATGTGCTGGTGACCGTTTCTCGAGAAACGGTCACCAGCACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000184.2-348s21c1
Sequence:CCGGGTGGATCCTGAGAACTTCAAGCTCGAGCTTGAAGTTCTCAGGATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)