EMAIL THIS PAGE TO A FRIEND

HBM

hemoglobin, mu

15 Gene Product Result for
Synonyms: HBAP2
UniProtKB ID: Q6B0K9
Gene ID:
Human(3042) Summary: The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. This gene has an ORF encoding a 141 aa polypeptide which is similar to the delta globins found in reptiles and birds. This locus was originally described as a pseudogene; however, it is currently thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
domestic cat(101097036) hemoglobin, mu
cow(100140603) hemoglobin, mu
sheep(101108535) hemoglobin, mu
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302704 ANTI-HBM (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003938 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003938 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095328 predicted 225
2 SASI_Hs01_00095329 predicted 226
3 SASI_Hs01_00095330 predicted 218
4 SASI_Hs02_00304428 predicted 466
5 SASI_Hs01_00095331 predicted 310
6 SASI_Hs01_00095332 predicted 56
7 SASI_Hs01_00095333 predicted 316
8 SASI_Hs01_00095334 predicted 45
9 SASI_Hs01_00095335 predicted 300
10 SASI_Hs01_00095336 predicted 470
11 SASI_Hs01_00095337 predicted 59
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003938
HBM MISSION shRNA Bacterial Glycerol Stock
hemoglobin, mu
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-311s21c1
Sequence:CCGGCCAACTTTCCGCTGCTAATCCCTCGAGGGATTAGCAGCGGAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-112s21c1
Sequence:CCGGCTCAGGCTCTTCACGGTGTACCTCGAGGTACACCGTGAAGAGCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-299s21c1
Sequence:CCGGGCGTGGACCCAGCCAACTTTCCTCGAGGAAAGTTGGCTGGGTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-328s21c1
Sequence:CCGGATCCAGTGTTTCCACGTCGTGCTCGAGCACGACGTGGAAACACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-141s21c1
Sequence:CCGGCAAGGTCTACTTCCCGCACCTCTCGAGAGGTGCGGGAAGTAGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003938
HBM MISSION shRNA shRNA Plasmid DNA
hemoglobin, mu
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-311s21c1
Sequence:CCGGCCAACTTTCCGCTGCTAATCCCTCGAGGGATTAGCAGCGGAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-112s21c1
Sequence:CCGGCTCAGGCTCTTCACGGTGTACCTCGAGGTACACCGTGAAGAGCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-299s21c1
Sequence:CCGGGCGTGGACCCAGCCAACTTTCCTCGAGGAAAGTTGGCTGGGTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-328s21c1
Sequence:CCGGATCCAGTGTTTCCACGTCGTGCTCGAGCACGACGTGGAAACACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-141s21c1
Sequence:CCGGCAAGGTCTACTTCCCGCACCTCTCGAGAGGTGCGGGAAGTAGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003938
HBM MISSION shRNA Lentiviral Transduction Particles
hemoglobin, mu
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-311s21c1
Sequence:CCGGCCAACTTTCCGCTGCTAATCCCTCGAGGGATTAGCAGCGGAAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-112s21c1
Sequence:CCGGCTCAGGCTCTTCACGGTGTACCTCGAGGTACACCGTGAAGAGCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-299s21c1
Sequence:CCGGGCGTGGACCCAGCCAACTTTCCTCGAGGAAAGTTGGCTGGGTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-328s21c1
Sequence:CCGGATCCAGTGTTTCCACGTCGTGCTCGAGCACGACGTGGAAACACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003938.3-141s21c1
Sequence:CCGGCAAGGTCTACTTCCCGCACCTCTCGAGAGGTGCGGGAAGTAGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)