EMAIL THIS PAGE TO A FRIEND

HBP1

HMG-box transcription factor 1

190 Gene Product Result for
UniProtKB ID: O60381, B3KVB7, Q8TBM1, Q8TE93, Q96AJ2
Gene ID:
Mouse(73389) high mobility group box transcription factor 1
Rat(27080) HMG-box transcription factor 1
sheep(101103467) HMG-box transcription factor 1
Domestic Rabbit(100344904) HMG-box transcription factor 1
domestic guinea pig(100724848) HMG-box transcription factor 1
naked mole-rat(101706080) HMG-box transcription factor 1
Zebrafish(554137) HMG-box transcription factor 1
domestic cat(101095964) HMG-box transcription factor 1
cow(515320) HMG-box transcription factor 1
Horse(100050609) HMG-box transcription factor 1
dog(475886) HMG-box transcription factor 1
chicken(417705) HMG-box transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131981 MISSION® esiRNA esiRNA human HBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012257 Rosetta Predictions human pricing
NM_013221 Rosetta Predictions rat pricing
NM_153198 Rosetta Predictions mouse pricing
NM_177993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102908 predicted 256
2 SASI_Hs01_00102909 predicted 553
3 SASI_Hs02_00343969 predicted 1767
4 SASI_Hs02_00343970 predicted 1615
5 SASI_Hs01_00102910 predicted 1421
6 SASI_Hs01_00102911 predicted 213
7 SASI_Hs01_00102912 predicted 1629
8 SASI_Hs01_00102913 predicted 1410
9 SASI_Hs02_00343971 predicted 594
10 SASI_Hs02_00343972 predicted 1789
11 SASI_Hs01_00102907 predicted 1751
12 SASI_Hs01_00102914 predicted 1766
13 SASI_Hs01_00102915 predicted 1725
14 SASI_Hs01_00102916 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261085 predicted 1098
2 SASI_Rn01_00119652 predicted 845
3 SASI_Rn01_00119654 predicted 993
4 SASI_Rn01_00119655 predicted 408
5 SASI_Rn02_00261086 predicted 865
6 SASI_Rn01_00119657 predicted 813
7 SASI_Rn01_00119658 predicted 1555
8 SASI_Rn01_00119660 predicted 888
9 SASI_Rn02_00261087 predicted 214
10 SASI_Rn02_00261088 predicted 1009
11 SASI_Rn01_00119653 predicted 398
12 SASI_Rn01_00119656 predicted 554
13 SASI_Rn01_00119659 predicted 1345
14 SASI_Rn01_00119661 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108579 predicted 1108
2 SASI_Mm01_00108580 predicted 204
3 SASI_Mm01_00108581 predicted 855
4 SASI_Mm01_00108582 predicted 815
5 SASI_Mm01_00108583 predicted 256
6 SASI_Mm01_00108584 predicted 445
7 SASI_Mm01_00108585 predicted 223
8 SASI_Mm01_00108586 predicted 1130
9 SASI_Mm02_00343124 predicted 270
10 SASI_Mm02_00343125 predicted 875
11 SASI_Mm01_00108587 predicted 774
12 SASI_Mm01_00108588 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021259 predicted 1110
2 SASI_Mm01_00021260 predicted 206
3 SASI_Mm01_00021261 predicted 854
4 SASI_Mm01_00021262 predicted 823
5 SASI_Mm01_00021263 predicted 257
6 SASI_Mm01_00021264 predicted 447
7 SASI_Mm01_00021265 predicted 214
8 SASI_Mm01_00021266 predicted 1128
9 SASI_Mm02_00348455 predicted 267
10 SASI_Mm02_00348456 predicted 882
11 SASI_Mm01_00021267 predicted 769
12 SASI_Mm01_00021268 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153198
VALIDATED
HBP1 MISSION shRNA Bacterial Glycerol Stock
HMG-box transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-1393s21c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-811s21c1
Sequence:CCGGCTATGGGTCTGATGGTCTAAACTCGAGTTTAGACCATCAGACCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-247s21c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153198.1-2475s21c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-708s21c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-2475s1c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-247s1c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-708s1c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-1393s1c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153198.1-176s1c1
Sequence:CCGGCCAGGATACAACTCCTGTGATCTCGAGATCACAGGAGTTGTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153198
VALIDATED
HBP1 MISSION shRNA shRNA Plasmid DNA
HMG-box transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-1393s21c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-811s21c1
Sequence:CCGGCTATGGGTCTGATGGTCTAAACTCGAGTTTAGACCATCAGACCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-247s21c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153198.1-2475s21c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-708s21c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-2475s1c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-247s1c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-708s1c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-1393s1c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153198.1-176s1c1
Sequence:CCGGCCAGGATACAACTCCTGTGATCTCGAGATCACAGGAGTTGTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153198
VALIDATED
HBP1 MISSION shRNA Lentiviral Transduction Particles
HMG-box transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-1393s21c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-811s21c1
Sequence:CCGGCTATGGGTCTGATGGTCTAAACTCGAGTTTAGACCATCAGACCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-247s21c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153198.1-2475s21c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153198.1-708s21c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-2475s1c1
Sequence:CCGGGCTACAATCATGGCTTCTCATCTCGAGATGAGAAGCCATGATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-247s1c1
Sequence:CCGGCCCTACCCAATCTGCCATATACTCGAGTATATGGCAGATTGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-708s1c1
Sequence:CCGGGCTTCCATAAGGAAAGCAATACTCGAGTATTGCTTTCCTTATGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153198.1-1393s1c1
Sequence:CCGGCAGAGTTGAATATACTCAGATCTCGAGATCTGAGTATATTCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153198.1-176s1c1
Sequence:CCGGCCAGGATACAACTCCTGTGATCTCGAGATCACAGGAGTTGTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012257
VALIDATED
HBP1 MISSION shRNA Bacterial Glycerol Stock
HMG-box transcription factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1826s21c1
Sequence:GTACCGGATTCGTGTGACCATAAGATACCTCGAGGTATCTTATGGTCACACGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1167s21c1
Sequence:GTACCGGAGTTCATATTGGCGATGTATGCTCGAGCATACATCGCCAATATGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-782s21c1
Sequence:GTACCGGATGATTTGGGATGGTGCAATTCTCGAGAATTGCACCATCCCAAATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1659s21c1
Sequence:CCGGTGAAGAACAGAAACGTTTAAACTCGAGTTTAAACGTTTCTGTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-954s21c1
Sequence:CCGGCTATGGTTCTGATGGTCTAAACTCGAGTTTAGACCATCAGAACCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-556s1c1
Sequence:CCGGCCACTGATGCAGTGCTCATTTCTCGAGAAATGAGCACTGCATCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012257.2-470s1c1
Sequence:CCGGCCTCAGACATACCAGAAACTACTCGAGTAGTTTCTGGTATGTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-962s1c1
Sequence:CCGGCTGATGGTCTAAAGTTGTTATCTCGAGATAACAACTTTAGACCATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1464s1c1
Sequence:CCGGGAGTGCCACTTCTCCTAATAACTCGAGTTATTAGGAGAAGTGGCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1645s1c1
Sequence:CCGGGCAAAGGCTTTGGCTGAAGAACTCGAGTTCTTCAGCCAAAGCCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012257
VALIDATED
HBP1 MISSION shRNA shRNA Plasmid DNA
HMG-box transcription factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1826s21c1
Sequence:GTACCGGATTCGTGTGACCATAAGATACCTCGAGGTATCTTATGGTCACACGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1167s21c1
Sequence:GTACCGGAGTTCATATTGGCGATGTATGCTCGAGCATACATCGCCAATATGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-782s21c1
Sequence:GTACCGGATGATTTGGGATGGTGCAATTCTCGAGAATTGCACCATCCCAAATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1659s21c1
Sequence:CCGGTGAAGAACAGAAACGTTTAAACTCGAGTTTAAACGTTTCTGTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-954s21c1
Sequence:CCGGCTATGGTTCTGATGGTCTAAACTCGAGTTTAGACCATCAGAACCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-556s1c1
Sequence:CCGGCCACTGATGCAGTGCTCATTTCTCGAGAAATGAGCACTGCATCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012257.2-470s1c1
Sequence:CCGGCCTCAGACATACCAGAAACTACTCGAGTAGTTTCTGGTATGTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-962s1c1
Sequence:CCGGCTGATGGTCTAAAGTTGTTATCTCGAGATAACAACTTTAGACCATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1464s1c1
Sequence:CCGGGAGTGCCACTTCTCCTAATAACTCGAGTTATTAGGAGAAGTGGCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1645s1c1
Sequence:CCGGGCAAAGGCTTTGGCTGAAGAACTCGAGTTCTTCAGCCAAAGCCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012257
VALIDATED
HBP1 MISSION shRNA Lentiviral Transduction Particles
HMG-box transcription factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1826s21c1
Sequence:GTACCGGATTCGTGTGACCATAAGATACCTCGAGGTATCTTATGGTCACACGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1167s21c1
Sequence:GTACCGGAGTTCATATTGGCGATGTATGCTCGAGCATACATCGCCAATATGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-782s21c1
Sequence:GTACCGGATGATTTGGGATGGTGCAATTCTCGAGAATTGCACCATCCCAAATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-1659s21c1
Sequence:CCGGTGAAGAACAGAAACGTTTAAACTCGAGTTTAAACGTTTCTGTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012257.3-954s21c1
Sequence:CCGGCTATGGTTCTGATGGTCTAAACTCGAGTTTAGACCATCAGAACCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-556s1c1
Sequence:CCGGCCACTGATGCAGTGCTCATTTCTCGAGAAATGAGCACTGCATCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012257.2-470s1c1
Sequence:CCGGCCTCAGACATACCAGAAACTACTCGAGTAGTTTCTGGTATGTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-962s1c1
Sequence:CCGGCTGATGGTCTAAAGTTGTTATCTCGAGATAACAACTTTAGACCATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1464s1c1
Sequence:CCGGGAGTGCCACTTCTCCTAATAACTCGAGTTATTAGGAGAAGTGGCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012257.2-1645s1c1
Sequence:CCGGGCAAAGGCTTTGGCTGAAGAACTCGAGTTCTTCAGCCAAAGCCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)