EMAIL THIS PAGE TO A FRIEND

HBQ1

hemoglobin, theta 1

38 Gene Product Result for
UniProtKB ID: P09105, Q13723, Q1W6G5
Gene ID:
Human(3049) Summary: Theta-globin mRNA is found in human fetal erythroid tissue but not in adult erythroid or other nonerythroid tissue. The theta-1 gene may be expressed very early in embryonic life, perhaps sometime before 5 weeks. Theta-1 is a member of the human alpha-globin gene cluster that involves five functional genes and two pseudogenes. The order of genes is: 5' - zeta - pseudozeta - mu - pseudoalpha-2 -pseudoalpha-1 - alpha-2 - alpha-1 - theta-1 - 3'. Research supports a transcriptionally active role for the gene and a functional role for the peptide in specific cells, possibly those of early erythroid tissue. [provided by RefSeq, Jul 2008]
Rat(303007) hemoglobin, theta 1
cow(618325) hemoglobin, theta 1
Horse(100066424) hemoglobin, theta 1
domestic cat(101096780) hemoglobin, theta 1
domestic guinea pig(100717416) hemoglobin, theta 1
naked mole-rat(101724100) hemoglobin, theta 1
sheep(101121393) hemoglobin, theta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005331 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121491 MISSION® esiRNA esiRNA human HBQ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005331 Rosetta Predictions human pricing
XM_001061675 Rosetta Predictions rat pricing
XM_347266 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155580 predicted 351
2 SASI_Hs01_00155581 predicted 297
3 SASI_Hs01_00155582 predicted 340
4 SASI_Hs01_00155583 predicted 407
5 SASI_Hs01_00155584 predicted 355
6 SASI_Hs01_00155588 predicted 402
7 SASI_Hs01_00155585 predicted 425
8 SASI_Hs01_00155586 predicted 231
9 SASI_Hs01_00155587 predicted 237
10 SASI_Hs02_00339398 predicted 549
11 SASI_Hs01_00155579 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300948 predicted 539
2 SASI_Rn02_00300949 predicted 221
3 SASI_Rn02_00300950 predicted 223
4 SASI_Rn02_00300951 predicted 272
5 SASI_Rn02_00300952 predicted 579
6 SASI_Rn02_00300953 predicted 578
7 SASI_Rn02_00300954 predicted 408
8 SASI_Rn02_00300955 predicted 572
9 SASI_Rn02_00300956 predicted 462
10 SASI_Rn02_00300957 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399626 predicted 536
2 SASI_Rn02_00399627 predicted 228
3 SASI_Rn02_00399628 predicted 226
4 SASI_Rn02_00399629 predicted 271
5 SASI_Rn02_00399630 predicted 587
6 SASI_Rn02_00399631 predicted 577
7 SASI_Rn02_00399632 predicted 405
8 SASI_Rn02_00399633 predicted 572
9 SASI_Rn02_00399634 predicted 456
10 SASI_Rn02_00399635 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005331
HBQ1 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, theta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-214s1c1
Sequence:CCGGCGTCGGCGTCTACACGACAGACTCGAGTCTGTCGTGTAGACGCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-302s1c1
Sequence:CCGGCCCGGCTCCTCACAAGTCAGACTCGAGTCTGACTTGTGAGGAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-240s1c1
Sequence:CCGGTGGAAAGGACCTTCCTGGCTTCTCGAGAAGCCAGGAAGGTCCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-264s1c1
Sequence:CCGGCCGCCACGAAGACCTACTTCTCTCGAGAGAAGTAGGTCTTCGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-277s21c1
Sequence:CCGGCTACTTCTCCCACCTGGACCTCTCGAGAGGTCCAGGTGGGAGAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-225s21c1
Sequence:CCGGACACGACAGAGGCCCTGGAAACTCGAGTTTCCAGGGCCTCTGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-265s21c1
Sequence:CCGGCGCCACGAAGACCTACTTCTCCTCGAGGAGAAGTAGGTCTTCGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-316s21c1
Sequence:CCGGAGTCAGAGCCCACGGCCAGAACTCGAGTTCTGGCCGTGGGCTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-241s21c1
Sequence:CCGGGGAAAGGACCTTCCTGGCTTTCTCGAGAAAGCCAGGAAGGTCCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005331
HBQ1 MISSION shRNA shRNA Plasmid DNA
hemoglobin, theta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-214s1c1
Sequence:CCGGCGTCGGCGTCTACACGACAGACTCGAGTCTGTCGTGTAGACGCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-302s1c1
Sequence:CCGGCCCGGCTCCTCACAAGTCAGACTCGAGTCTGACTTGTGAGGAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-240s1c1
Sequence:CCGGTGGAAAGGACCTTCCTGGCTTCTCGAGAAGCCAGGAAGGTCCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-264s1c1
Sequence:CCGGCCGCCACGAAGACCTACTTCTCTCGAGAGAAGTAGGTCTTCGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-277s21c1
Sequence:CCGGCTACTTCTCCCACCTGGACCTCTCGAGAGGTCCAGGTGGGAGAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-225s21c1
Sequence:CCGGACACGACAGAGGCCCTGGAAACTCGAGTTTCCAGGGCCTCTGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-265s21c1
Sequence:CCGGCGCCACGAAGACCTACTTCTCCTCGAGGAGAAGTAGGTCTTCGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-316s21c1
Sequence:CCGGAGTCAGAGCCCACGGCCAGAACTCGAGTTCTGGCCGTGGGCTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-241s21c1
Sequence:CCGGGGAAAGGACCTTCCTGGCTTTCTCGAGAAAGCCAGGAAGGTCCTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005331
HBQ1 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, theta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-214s1c1
Sequence:CCGGCGTCGGCGTCTACACGACAGACTCGAGTCTGTCGTGTAGACGCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-302s1c1
Sequence:CCGGCCCGGCTCCTCACAAGTCAGACTCGAGTCTGACTTGTGAGGAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-240s1c1
Sequence:CCGGTGGAAAGGACCTTCCTGGCTTCTCGAGAAGCCAGGAAGGTCCTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005331.3-264s1c1
Sequence:CCGGCCGCCACGAAGACCTACTTCTCTCGAGAGAAGTAGGTCTTCGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-277s21c1
Sequence:CCGGCTACTTCTCCCACCTGGACCTCTCGAGAGGTCCAGGTGGGAGAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-225s21c1
Sequence:CCGGACACGACAGAGGCCCTGGAAACTCGAGTTTCCAGGGCCTCTGTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-265s21c1
Sequence:CCGGCGCCACGAAGACCTACTTCTCCTCGAGGAGAAGTAGGTCTTCGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-316s21c1
Sequence:CCGGAGTCAGAGCCCACGGCCAGAACTCGAGTTCTGGCCGTGGGCTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005331.3-241s21c1
Sequence:CCGGGGAAAGGACCTTCCTGGCTTTCTCGAGAAAGCCAGGAAGGTCCTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)