EMAIL THIS PAGE TO A FRIEND

HBS1L

HBS1-like (S. cerevisiae)

103 Gene Product Result for
Synonyms: EF-1a ERFS HBS1 HSPC276
Gene ID:
Human(10767) Summary: This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(56422) Hbs1-like (S. cerevisiae)
Rat(293408) Hbs1-like (S. cerevisiae)
Zebrafish(324267) HBS1-like (S. cerevisiae)
domestic cat(101100135) HBS1-like (S. cerevisiae)
dog(476211) HBS1-like (S. cerevisiae)
cow(541083) HBS1-like (S. cerevisiae)
chicken(421694) HBS1-like (S. cerevisiae)
sheep(101109622) HBS1-like (S. cerevisiae)
Domestic Rabbit(100338746) HBS1-like (S. cerevisiae)
domestic guinea pig(101787962) HBS1-like (S. cerevisiae)
naked mole-rat(101720674) HBS1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006620 Rosetta Predictions human pricing
NM_001011934 Rosetta Predictions rat pricing
XM_574272 Rosetta Predictions rat pricing
NM_001042593 Rosetta Predictions mouse pricing
NM_019702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204698 predicted 1627
2 SASI_Hs01_00204699 predicted 2012
3 SASI_Hs01_00204700 predicted 1656
4 SASI_Hs01_00204701 predicted 2097
5 SASI_Hs01_00204702 predicted 1125
6 SASI_Hs01_00204703 predicted 1908
7 SASI_Hs01_00204704 predicted 1782
8 SASI_Hs01_00204705 predicted 1835
9 SASI_Hs01_00204706 predicted 1156
10 SASI_Hs01_00204707 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072886 predicted 615
2 SASI_Rn01_00072887 predicted 354
3 SASI_Rn01_00072888 predicted 1711
4 SASI_Rn01_00072889 predicted 1446
5 SASI_Rn01_00072891 predicted 2188
6 SASI_Rn01_00072892 predicted 1891
7 SASI_Rn02_00199939 predicted 855
8 SASI_Rn01_00072893 predicted 894
9 SASI_Rn01_00072894 predicted 1654
10 SASI_Rn01_00072895 predicted 1463
11 SASI_Rn01_00072890 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159714 predicted 1650
2 SASI_Rn01_00159715 predicted 1390
3 SASI_Rn01_00159716 predicted 1847
4 SASI_Rn01_00159717 predicted 2137
5 SASI_Rn01_00159718 predicted 1829
6 SASI_Rn01_00159719 predicted 790
7 SASI_Rn01_00159720 predicted 842
8 SASI_Rn01_00159721 predicted 1597
9 SASI_Rn01_00159722 predicted 1408
10 SASI_Rn01_00159723 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290675 predicted 1714
2 SASI_Mm02_00290676 predicted 1599
3 SASI_Mm02_00290677 predicted 1139
4 SASI_Mm02_00290678 predicted 1101
5 SASI_Mm02_00290679 predicted 867
6 SASI_Mm02_00290680 predicted 1980
7 SASI_Mm02_00290681 predicted 1351
8 SASI_Mm02_00290682 predicted 1963
9 SASI_Mm02_00290683 predicted 931
10 SASI_Mm02_00290684 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097268 predicted 1720
2 SASI_Mm01_00097269 predicted 1614
3 SASI_Mm01_00097270 predicted 1140
4 SASI_Mm01_00097271 predicted 1116
5 SASI_Mm02_00324805 predicted 875
6 SASI_Mm01_00097272 predicted 1990
7 SASI_Mm01_00097273 predicted 1355
8 SASI_Mm01_00097274 predicted 1971
9 SASI_Mm01_00097275 predicted 935
10 SASI_Mm02_00324806 predicted 1551
11 SASI_Mm01_00097267 predicted 299
12 SASI_Mm01_00097276 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006620
VALIDATED
HBS1L MISSION shRNA Bacterial Glycerol Stock
HBS1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-445s21c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-2141s1c1
Sequence:CCGGCCAATAGCTCTTGAGCTATATCTCGAGATATAGCTCAAGAGCTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-431s1c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-1636s1c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-3117s1c1
Sequence:CCGGGCCCTTTCTTTATCTTGCTTACTCGAGTAAGCAAGATAAAGAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-503s1c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-517s21c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-2481s21c1
Sequence:CCGGTTTGCCTTTGAAACGTTAATACTCGAGTATTAACGTTTCAAAGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-1650s21c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-5020s1c1
Sequence:CCGGCCCATGAGTATGCAAATCAATCTCGAGATTGATTTGCATACTCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006620
VALIDATED
HBS1L MISSION shRNA shRNA Plasmid DNA
HBS1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-445s21c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-2141s1c1
Sequence:CCGGCCAATAGCTCTTGAGCTATATCTCGAGATATAGCTCAAGAGCTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-431s1c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-1636s1c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-3117s1c1
Sequence:CCGGGCCCTTTCTTTATCTTGCTTACTCGAGTAAGCAAGATAAAGAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-503s1c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-517s21c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-2481s21c1
Sequence:CCGGTTTGCCTTTGAAACGTTAATACTCGAGTATTAACGTTTCAAAGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-1650s21c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-5020s1c1
Sequence:CCGGCCCATGAGTATGCAAATCAATCTCGAGATTGATTTGCATACTCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006620
VALIDATED
HBS1L MISSION shRNA Lentiviral Transduction Particles
HBS1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-445s21c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-2141s1c1
Sequence:CCGGCCAATAGCTCTTGAGCTATATCTCGAGATATAGCTCAAGAGCTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-431s1c1
Sequence:CCGGCGTCTTTATTCATGCCTTGATCTCGAGATCAAGGCATGAATAAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-1636s1c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-3117s1c1
Sequence:CCGGGCCCTTTCTTTATCTTGCTTACTCGAGTAAGCAAGATAAAGAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006620.2-503s1c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-517s21c1
Sequence:CCGGGCAGTTCTGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-2481s21c1
Sequence:CCGGTTTGCCTTTGAAACGTTAATACTCGAGTATTAACGTTTCAAAGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006620.3-1650s21c1
Sequence:CCGGGCGATCTATTGACAAACCTTTCTCGAGAAAGGTTTGTCAATAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006620.2-5020s1c1
Sequence:CCGGCCCATGAGTATGCAAATCAATCTCGAGATTGATTTGCATACTCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019702
VALIDATED
HBS1L MISSION shRNA Bacterial Glycerol Stock
HBS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-787s1c1
Sequence:CCGGGCTCCTCAACTTAGTGGTCATCTCGAGATGACCACTAAGTTGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1981s21c1
Sequence:CCGGCTGTTATTAAGCGATTGATTACTCGAGTAATCAATCGCTTAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1917s21c1
Sequence:CCGGATTGAAGTTCCGATCACTAAACTCGAGTTTAGTGATCGGAACTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1129s21c1
Sequence:CCGGACGTCGGAATGACGAAGTTTGCTCGAGCAAACTTCGTCATTCCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2137s21c1
Sequence:CCGGGGCGGTTTATGCTGCGTTATGCTCGAGCATAACGCAGCATAAACCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2326s21c1
Sequence:CCGGTTAGCTGCCAACAAGTATTAACTCGAGTTAATACTTGTTGGCAGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019702.2-2325s1c1
Sequence:CCGGGTTAGCTGCCAACAAGTATTACTCGAGTAATACTTGTTGGCAGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-1841s1c1
Sequence:CCGGGCTGTTATTAAGCGATTGATTCTCGAGAATCAATCGCTTAATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019702
VALIDATED
HBS1L MISSION shRNA shRNA Plasmid DNA
HBS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-787s1c1
Sequence:CCGGGCTCCTCAACTTAGTGGTCATCTCGAGATGACCACTAAGTTGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1981s21c1
Sequence:CCGGCTGTTATTAAGCGATTGATTACTCGAGTAATCAATCGCTTAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1917s21c1
Sequence:CCGGATTGAAGTTCCGATCACTAAACTCGAGTTTAGTGATCGGAACTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1129s21c1
Sequence:CCGGACGTCGGAATGACGAAGTTTGCTCGAGCAAACTTCGTCATTCCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2137s21c1
Sequence:CCGGGGCGGTTTATGCTGCGTTATGCTCGAGCATAACGCAGCATAAACCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2326s21c1
Sequence:CCGGTTAGCTGCCAACAAGTATTAACTCGAGTTAATACTTGTTGGCAGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019702.2-2325s1c1
Sequence:CCGGGTTAGCTGCCAACAAGTATTACTCGAGTAATACTTGTTGGCAGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-1841s1c1
Sequence:CCGGGCTGTTATTAAGCGATTGATTCTCGAGAATCAATCGCTTAATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019702
VALIDATED
HBS1L MISSION shRNA Lentiviral Transduction Particles
HBS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-787s1c1
Sequence:CCGGGCTCCTCAACTTAGTGGTCATCTCGAGATGACCACTAAGTTGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1981s21c1
Sequence:CCGGCTGTTATTAAGCGATTGATTACTCGAGTAATCAATCGCTTAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1917s21c1
Sequence:CCGGATTGAAGTTCCGATCACTAAACTCGAGTTTAGTGATCGGAACTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-1129s21c1
Sequence:CCGGACGTCGGAATGACGAAGTTTGCTCGAGCAAACTTCGTCATTCCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2137s21c1
Sequence:CCGGGGCGGTTTATGCTGCGTTATGCTCGAGCATAACGCAGCATAAACCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019702.2-2326s21c1
Sequence:CCGGTTAGCTGCCAACAAGTATTAACTCGAGTTAATACTTGTTGGCAGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019702.2-2325s1c1
Sequence:CCGGGTTAGCTGCCAACAAGTATTACTCGAGTAATACTTGTTGGCAGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019702.1-1841s1c1
Sequence:CCGGGCTGTTATTAAGCGATTGATTCTCGAGAATCAATCGCTTAATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)