EMAIL THIS PAGE TO A FRIEND

HBZ

hemoglobin, zeta

36 Gene Product Result for
UniProtKB ID: P02008, Q6IBF6
Gene ID:
Human(3050) Summary: Zeta-globin is an alpha-like hemoglobin. The zeta-globin polypeptide is synthesized in the yolk sac of the early embryo, while alpha-globin is produced throughout fetal and adult life. The zeta-globin gene is a member of the human alpha-globin gene cluster that includes five functional genes and two pseudogenes. The order of genes is: 5' - zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 -alpha-1 - theta1 - 3'. [provided by RefSeq, Nov 2009]
Rat(287168) hemoglobin, zeta
Zebrafish(561790) hemoglobin zeta
domestic cat(101097290) hemoglobin, zeta
cow(504564) Hemoglobin subunit zeta-like
cow(100138582) hemoglobin, zeta
chicken(416650) hemoglobin, zeta
sheep(101120884) hemoglobin, zeta
naked mole-rat(101705305) hemoglobin, zeta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005332 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117261 MISSION® esiRNA esiRNA human HBZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005332 Rosetta Predictions human pricing
XM_213268 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016896 predicted 288
2 SASI_Hs01_00016897 predicted 256
3 SASI_Hs01_00016898 predicted 251
4 SASI_Hs01_00016899 predicted 243
5 SASI_Hs01_00016900 predicted 241
6 SASI_Hs01_00016901 predicted 225
7 SASI_Hs01_00016902 predicted 359
8 SASI_Hs01_00016903 predicted 327
9 SASI_Hs01_00016904 predicted 280
10 SASI_Hs01_00016905 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143337 predicted 314
2 SASI_Rn01_00143338 predicted 241
3 SASI_Rn01_00143339 predicted 258
4 SASI_Rn01_00143340 predicted 288
5 SASI_Rn01_00143341 predicted 271
6 SASI_Rn01_00143342 predicted 318
7 SASI_Rn01_00143343 predicted 316
8 SASI_Rn01_00143344 predicted 264
9 SASI_Rn01_00143345 predicted 327
10 SASI_Rn01_00143346 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005332
HBZ MISSION shRNA Bacterial Glycerol Stock
hemoglobin, zeta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-435s1c1
Sequence:CCGGACAAGTTCCTATCGGTCGTATCTCGAGATACGACCGATAGGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-262s1c1
Sequence:CCGGCGCGGTGAAGAGCATCGACGACTCGAGTCGTCGATGCTCTTCACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-316s1c1
Sequence:CCGGGCACGCCTACATCCTGCGCGTCTCGAGACGCGCAGGATGTAGGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-85s1c1
Sequence:CCGGCATTGTGTCCATGTGGGCCAACTCGAGTTGGCCCACATGGACACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-166s1c1
Sequence:CCGGCCCGCAGACCAAGACCTACTTCTCGAGAAGTAGGTCTTGGTCTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-458s21c1
Sequence:CCGGTCTGTCCTGACCGAGAAGTACCTCGAGGTACTTCTCGGTCAGGACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-181s21c1
Sequence:CCGGCTACTTCCCGCACTTCGACCTCTCGAGAGGTCGAAGTGCGGGAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-139s21c1
Sequence:CCGGGACTCTGGAGAGGCTCTTCCTCTCGAGAGGAAGAGCCTCTCCAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005332
HBZ MISSION shRNA shRNA Plasmid DNA
hemoglobin, zeta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-435s1c1
Sequence:CCGGACAAGTTCCTATCGGTCGTATCTCGAGATACGACCGATAGGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-262s1c1
Sequence:CCGGCGCGGTGAAGAGCATCGACGACTCGAGTCGTCGATGCTCTTCACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-316s1c1
Sequence:CCGGGCACGCCTACATCCTGCGCGTCTCGAGACGCGCAGGATGTAGGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-85s1c1
Sequence:CCGGCATTGTGTCCATGTGGGCCAACTCGAGTTGGCCCACATGGACACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-166s1c1
Sequence:CCGGCCCGCAGACCAAGACCTACTTCTCGAGAAGTAGGTCTTGGTCTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-458s21c1
Sequence:CCGGTCTGTCCTGACCGAGAAGTACCTCGAGGTACTTCTCGGTCAGGACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-181s21c1
Sequence:CCGGCTACTTCCCGCACTTCGACCTCTCGAGAGGTCGAAGTGCGGGAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-139s21c1
Sequence:CCGGGACTCTGGAGAGGCTCTTCCTCTCGAGAGGAAGAGCCTCTCCAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005332
HBZ MISSION shRNA Lentiviral Transduction Particles
hemoglobin, zeta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-435s1c1
Sequence:CCGGACAAGTTCCTATCGGTCGTATCTCGAGATACGACCGATAGGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-262s1c1
Sequence:CCGGCGCGGTGAAGAGCATCGACGACTCGAGTCGTCGATGCTCTTCACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-316s1c1
Sequence:CCGGGCACGCCTACATCCTGCGCGTCTCGAGACGCGCAGGATGTAGGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-85s1c1
Sequence:CCGGCATTGTGTCCATGTGGGCCAACTCGAGTTGGCCCACATGGACACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005332.2-166s1c1
Sequence:CCGGCCCGCAGACCAAGACCTACTTCTCGAGAAGTAGGTCTTGGTCTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-458s21c1
Sequence:CCGGTCTGTCCTGACCGAGAAGTACCTCGAGGTACTTCTCGGTCAGGACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-181s21c1
Sequence:CCGGCTACTTCCCGCACTTCGACCTCTCGAGAGGTCGAAGTGCGGGAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005332.2-139s21c1
Sequence:CCGGGACTCTGGAGAGGCTCTTCCTCTCGAGAGGAAGAGCCTCTCCAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)