EMAIL THIS PAGE TO A FRIEND

HCAR1

hydroxycarboxylic acid receptor 1

37 Gene Product Result for
Synonyms: GPR104 GPR81 HCA1 LACR1 TA-GPCR
UniProtKB ID: Q9BXC0, B2R9X4, Q3Y5J3, Q4VBN1, Q6NXU5
Gene ID:
Human(27198) Summary: G protein-coupled receptors (GPCRs, or GPRs), such as GPR81, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Feb 2005]
Rat(369158) Hepatocarcinoma resistance QTL 1
cow(538759) hydroxycarboxylic acid receptor 1
sheep(101119758) hydroxycarboxylic acid receptor 1
domestic guinea pig(100712976) hydroxycarboxylic acid receptor 1
naked mole-rat(101698581) hydroxycarboxylic acid receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032554 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002961 MISSION® esiRNA esiRNA targeting human GPR81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101136 predicted 1306
2 SASI_Hs02_00360063 predicted 1216
3 SASI_Hs01_00101137 predicted 1306
4 SASI_Hs01_00101138 predicted 1259
5 SASI_Hs01_00101140 predicted 1164
6 SASI_Hs01_00101141 predicted 452
7 SASI_Hs01_00101142 predicted 1207
8 SASI_Hs01_00101143 predicted 310
9 SASI_Hs01_00101144 predicted 1300
10 SASI_Hs01_00101145 predicted 1233
11 SASI_Hs01_00101139 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032554
HCAR1 MISSION shRNA Bacterial Glycerol Stock
hydroxycarboxylic acid receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-354s1c1
Sequence:CCGGGTGTGGTTTCTGCTTCCACATCTCGAGATGTGGAAGCAGAAACCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032554.2-2200s1c1
Sequence:CCGGCCCAAGAAGAACAACAACAAACTCGAGTTTGTTGTTGTTCTTCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-1217s1c1
Sequence:CCGGGTGTGGCAAATAGTTTCCAAACTCGAGTTTGGAAACTATTTGCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-571s1c1
Sequence:CCGGGCTGCGGACAGGTATTTCAAACTCGAGTTTGAAATACCTGTCCGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-951s1c1
Sequence:CCGGCGTGTCTGCTAGACTCTATTTCTCGAGAAATAGAGTCTAGCAGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1208s21c1
Sequence:CCGGGTTGCATCAGTGTGGCAAATACTCGAGTATTTGCCACACTGATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032554.3-1415s21c1
Sequence:CCGGCCTTCTCATTCTGTCGGAAATCTCGAGATTTCCGACAGAATGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1169s21c1
Sequence:CCGGGGCCGGAAGAGATGCCAATTTCTCGAGAAATTGGCATCTCTTCCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-952s21c1
Sequence:CCGGGTGTCTGCTAGACTCTATTTCCTCGAGGAAATAGAGTCTAGCAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032554
HCAR1 MISSION shRNA shRNA Plasmid DNA
hydroxycarboxylic acid receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-354s1c1
Sequence:CCGGGTGTGGTTTCTGCTTCCACATCTCGAGATGTGGAAGCAGAAACCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032554.2-2200s1c1
Sequence:CCGGCCCAAGAAGAACAACAACAAACTCGAGTTTGTTGTTGTTCTTCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-1217s1c1
Sequence:CCGGGTGTGGCAAATAGTTTCCAAACTCGAGTTTGGAAACTATTTGCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-571s1c1
Sequence:CCGGGCTGCGGACAGGTATTTCAAACTCGAGTTTGAAATACCTGTCCGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-951s1c1
Sequence:CCGGCGTGTCTGCTAGACTCTATTTCTCGAGAAATAGAGTCTAGCAGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1208s21c1
Sequence:CCGGGTTGCATCAGTGTGGCAAATACTCGAGTATTTGCCACACTGATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032554.3-1415s21c1
Sequence:CCGGCCTTCTCATTCTGTCGGAAATCTCGAGATTTCCGACAGAATGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1169s21c1
Sequence:CCGGGGCCGGAAGAGATGCCAATTTCTCGAGAAATTGGCATCTCTTCCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-952s21c1
Sequence:CCGGGTGTCTGCTAGACTCTATTTCCTCGAGGAAATAGAGTCTAGCAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032554
HCAR1 MISSION shRNA Lentiviral Transduction Particles
hydroxycarboxylic acid receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-354s1c1
Sequence:CCGGGTGTGGTTTCTGCTTCCACATCTCGAGATGTGGAAGCAGAAACCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032554.2-2200s1c1
Sequence:CCGGCCCAAGAAGAACAACAACAAACTCGAGTTTGTTGTTGTTCTTCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-1217s1c1
Sequence:CCGGGTGTGGCAAATAGTTTCCAAACTCGAGTTTGGAAACTATTTGCCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-571s1c1
Sequence:CCGGGCTGCGGACAGGTATTTCAAACTCGAGTTTGAAATACCTGTCCGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032554.2-951s1c1
Sequence:CCGGCGTGTCTGCTAGACTCTATTTCTCGAGAAATAGAGTCTAGCAGACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1208s21c1
Sequence:CCGGGTTGCATCAGTGTGGCAAATACTCGAGTATTTGCCACACTGATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032554.3-1415s21c1
Sequence:CCGGCCTTCTCATTCTGTCGGAAATCTCGAGATTTCCGACAGAATGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-1169s21c1
Sequence:CCGGGGCCGGAAGAGATGCCAATTTCTCGAGAAATTGGCATCTCTTCCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032554.3-952s21c1
Sequence:CCGGGTGTCTGCTAGACTCTATTTCCTCGAGGAAATAGAGTCTAGCAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)