EMAIL THIS PAGE TO A FRIEND

HCAR2

hydroxycarboxylic acid receptor 2

17 Gene Product Result for
Synonyms: GPR109A HCA2 HM74a HM74b NIACR1 PUMAG Puma-g
UniProtKB ID: Q8TDS4, A0PJL5, A7LGG3
Gene ID:
Rat(369160) Hepatocarcinoma resistance QTL 2
naked mole-rat(101713558) hydroxycarboxylic acid receptor 2
domestic cat(101088365) hydroxycarboxylic acid receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177551 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072810 predicted 376
2 SASI_Hs01_00072811 predicted 578
3 SASI_Hs01_00072812 predicted 588
4 SASI_Hs01_00072813 predicted 528
5 SASI_Hs01_00072814 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177551
HCAR2 MISSION shRNA Bacterial Glycerol Stock
hydroxycarboxylic acid receptor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-435s21c1
Sequence:CCGGGTGGCGGTAGACAGGTATTTCCTCGAGGAAATACCTGTCTACCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1281s21c1
Sequence:CCGGAGATTCAGAGAATGCGATTTACTCGAGTAAATCGCATTCTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-581s21c1
Sequence:CCGGCCAGAATGGCGGTGCAAATTTCTCGAGAAATTTGCACCGCCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1025s21c1
Sequence:CCGGGACAGGTGAGCCAGATAATAACTCGAGTTATTATCTGGCTCACCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-313s21c1
Sequence:CCGGTGCCCTTCCTGATGGACAACTCTCGAGAGTTGTCCATCAGGAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-381s21c1
Sequence:CCGGATGCTCTTCATGTTGGCTATGCTCGAGCATAGCCAACATGAAGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-563s1c1
Sequence:CCGGCGATCCAGAATGGCGGTGCAACTCGAGTTGCACCGCCATTCTGGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-123s1c1
Sequence:CCGGCCGAGATGACTTCATTGTCAACTCGAGTTGACAATGAAGTCATCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-311s1c1
Sequence:CCGGTGGACAACTATGTGAGGCGTTCTCGAGAACGCCTCACATAGTTGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1224s21c1
Sequence:CCGGTGGGCTGTTGCATCGAGTAATCTCGAGATTACTCGATGCAACAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1148s21c1
Sequence:CCGGGGGCCCAACCTCTCCTTAAATCTCGAGATTTAAGGAGAGGTTGGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177551
HCAR2 MISSION shRNA shRNA Plasmid DNA
hydroxycarboxylic acid receptor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-435s21c1
Sequence:CCGGGTGGCGGTAGACAGGTATTTCCTCGAGGAAATACCTGTCTACCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1281s21c1
Sequence:CCGGAGATTCAGAGAATGCGATTTACTCGAGTAAATCGCATTCTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-581s21c1
Sequence:CCGGCCAGAATGGCGGTGCAAATTTCTCGAGAAATTTGCACCGCCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1025s21c1
Sequence:CCGGGACAGGTGAGCCAGATAATAACTCGAGTTATTATCTGGCTCACCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-313s21c1
Sequence:CCGGTGCCCTTCCTGATGGACAACTCTCGAGAGTTGTCCATCAGGAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-381s21c1
Sequence:CCGGATGCTCTTCATGTTGGCTATGCTCGAGCATAGCCAACATGAAGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-563s1c1
Sequence:CCGGCGATCCAGAATGGCGGTGCAACTCGAGTTGCACCGCCATTCTGGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-123s1c1
Sequence:CCGGCCGAGATGACTTCATTGTCAACTCGAGTTGACAATGAAGTCATCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-311s1c1
Sequence:CCGGTGGACAACTATGTGAGGCGTTCTCGAGAACGCCTCACATAGTTGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1224s21c1
Sequence:CCGGTGGGCTGTTGCATCGAGTAATCTCGAGATTACTCGATGCAACAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1148s21c1
Sequence:CCGGGGGCCCAACCTCTCCTTAAATCTCGAGATTTAAGGAGAGGTTGGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177551
HCAR2 MISSION shRNA Lentiviral Transduction Particles
hydroxycarboxylic acid receptor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-435s21c1
Sequence:CCGGGTGGCGGTAGACAGGTATTTCCTCGAGGAAATACCTGTCTACCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1281s21c1
Sequence:CCGGAGATTCAGAGAATGCGATTTACTCGAGTAAATCGCATTCTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-581s21c1
Sequence:CCGGCCAGAATGGCGGTGCAAATTTCTCGAGAAATTTGCACCGCCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1025s21c1
Sequence:CCGGGACAGGTGAGCCAGATAATAACTCGAGTTATTATCTGGCTCACCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-313s21c1
Sequence:CCGGTGCCCTTCCTGATGGACAACTCTCGAGAGTTGTCCATCAGGAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-381s21c1
Sequence:CCGGATGCTCTTCATGTTGGCTATGCTCGAGCATAGCCAACATGAAGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-563s1c1
Sequence:CCGGCGATCCAGAATGGCGGTGCAACTCGAGTTGCACCGCCATTCTGGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-123s1c1
Sequence:CCGGCCGAGATGACTTCATTGTCAACTCGAGTTGACAATGAAGTCATCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177551.x-311s1c1
Sequence:CCGGTGGACAACTATGTGAGGCGTTCTCGAGAACGCCTCACATAGTTGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177551.3-1224s21c1
Sequence:CCGGTGGGCTGTTGCATCGAGTAATCTCGAGATTACTCGATGCAACAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177551.3-1148s21c1
Sequence:CCGGGGGCCCAACCTCTCCTTAAATCTCGAGATTTAAGGAGAGGTTGGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)