EMAIL THIS PAGE TO A FRIEND

HCCAT5

hepatocellular carcinoma associated transcript 5 (non-protein coding)

12 Gene Product Result for
Synonyms: HTA
Species: Human HCCAT5(283902)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322685 predicted 479
2 SASI_Hs02_00322686 predicted 357
3 SASI_Hs02_00322687 predicted 508
4 SASI_Hs02_00322688 predicted 432
5 SASI_Hs02_00322689 predicted 540
6 SASI_Hs02_00322690 predicted 354
7 SASI_Hs02_00322691 predicted 433
8 SASI_Hs02_00322692 predicted 451
9 SASI_Hs02_00322693 predicted 352
10 SASI_Hs02_00322694 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101347
HCCAT5 MISSION shRNA Bacterial Glycerol Stock
hepatocellular carcinoma associated transcript 5 (non-protein coding)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000263015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101347.1-643s21c1
Sequence:CCGGACGGAGAAGGATGAGTGAACTCTCGAGAGTTCACTCATCCTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-457s21c1
Sequence:CCGGTTTCGGGAAACTCTGGACGACCTCGAGGTCGTCCAGAGTTTCCCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-597s21c1
Sequence:CCGGTTGTCTTCATCTTGGGCTAACCTCGAGGTTAGCCCAAGATGAAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-373s21c1
Sequence:CCGGTTCTTCAGCAATGGATCAAAGCTCGAGCTTTGATCCATTGCTGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101347
HCCAT5 MISSION shRNA shRNA Plasmid DNA
hepatocellular carcinoma associated transcript 5 (non-protein coding)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000263015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101347.1-643s21c1
Sequence:CCGGACGGAGAAGGATGAGTGAACTCTCGAGAGTTCACTCATCCTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-457s21c1
Sequence:CCGGTTTCGGGAAACTCTGGACGACCTCGAGGTCGTCCAGAGTTTCCCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-597s21c1
Sequence:CCGGTTGTCTTCATCTTGGGCTAACCTCGAGGTTAGCCCAAGATGAAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-373s21c1
Sequence:CCGGTTCTTCAGCAATGGATCAAAGCTCGAGCTTTGATCCATTGCTGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101347
HCCAT5 MISSION shRNA Lentiviral Transduction Particles
hepatocellular carcinoma associated transcript 5 (non-protein coding)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000263015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101347.1-643s21c1
Sequence:CCGGACGGAGAAGGATGAGTGAACTCTCGAGAGTTCACTCATCCTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-457s21c1
Sequence:CCGGTTTCGGGAAACTCTGGACGACCTCGAGGTCGTCCAGAGTTTCCCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-597s21c1
Sequence:CCGGTTGTCTTCATCTTGGGCTAACCTCGAGGTTAGCCCAAGATGAAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101347.1-373s21c1
Sequence:CCGGTTCTTCAGCAATGGATCAAAGCTCGAGCTTTGATCCATTGCTGAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)