EMAIL THIS PAGE TO A FRIEND

HCCS

holocytochrome c synthase

105 Gene Product Result for
Synonyms: CCHL MCOPS7
UniProtKB ID: P53701, B3KUS1, Q502X8
Gene ID:
Human(3052) Summary: The protein encoded by this gene is an enzyme that covalently links a heme group to the apoprotein of cytochrome c. Defects in this gene are a cause of microphthalmia syndromic type 7 (MCOPS7). Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(15159) holocytochrome c synthetase
Rat(317444) holocytochrome c synthase
Zebrafish(58016) holocytochrome c synthase
cow(506250) holocytochrome c synthase
dog(480834) holocytochrome c synthase
chicken(424482) holocytochrome c synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005333 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122608 Rosetta Predictions human pricing
NM_005333 Rosetta Predictions human pricing
XM_001065465 Rosetta Predictions rat pricing
XM_228867 Rosetta Predictions rat pricing
NM_008222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327076 predicted 622
2 SASI_Hs02_00327077 predicted 479
3 SASI_Hs02_00327078 predicted 966
4 SASI_Hs02_00327079 predicted 1103
5 SASI_Hs02_00327080 predicted 436
6 SASI_Hs02_00327081 predicted 1079
7 SASI_Hs02_00327082 predicted 1006
8 SASI_Hs02_00327083 predicted 951
9 SASI_Hs02_00327084 predicted 1083
10 SASI_Hs02_00327085 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339399 predicted 681
2 SASI_Hs01_00176630 predicted 545
3 SASI_Hs01_00176631 predicted 1025
4 SASI_Hs01_00176632 predicted 1169
5 SASI_Hs01_00176633 predicted 497
6 SASI_Hs01_00176636 predicted 1132
7 SASI_Hs01_00176637 predicted 1063
8 SASI_Hs01_00176638 predicted 1007
9 SASI_Hs01_00176639 predicted 1150
10 SASI_Hs02_00339400 predicted 897
11 SASI_Hs01_00176634 predicted 891
12 SASI_Hs01_00176635 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314249 predicted 442
2 SASI_Rn02_00314250 predicted 830
3 SASI_Rn02_00314251 predicted 1046
4 SASI_Rn02_00314252 predicted 626
5 SASI_Rn02_00314253 predicted 801
6 SASI_Rn02_00314254 predicted 1008
7 SASI_Rn02_00314255 predicted 284
8 SASI_Rn02_00314256 predicted 306
9 SASI_Rn02_00314257 predicted 513
10 SASI_Rn02_00314258 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385595 predicted 445
2 SASI_Rn02_00385596 predicted 827
3 SASI_Rn02_00385597 predicted 1046
4 SASI_Rn02_00385598 predicted 618
5 SASI_Rn02_00385599 predicted 806
6 SASI_Rn02_00385600 predicted 1003
7 SASI_Rn02_00385601 predicted 279
8 SASI_Rn02_00385602 predicted 306
9 SASI_Rn02_00385603 predicted 516
10 SASI_Rn02_00385604 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118182 predicted 881
2 SASI_Mm01_00118183 predicted 568
3 SASI_Mm01_00118184 predicted 998
4 SASI_Mm01_00118185 predicted 760
5 SASI_Mm01_00118186 predicted 1105
6 SASI_Mm02_00313410 predicted 535
7 SASI_Mm01_00118187 predicted 854
8 SASI_Mm01_00118188 predicted 788
9 SASI_Mm01_00118190 predicted 767
10 SASI_Mm01_00118191 predicted 337
11 SASI_Mm01_00118189 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008222
VALIDATED
HCCS MISSION shRNA Bacterial Glycerol Stock
holocytochrome c synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-851s21c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-525s1c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-789s1c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-454s1c2
Sequence:CCGGCCTCGATCCTTCAAACCTGATCTCGAGATCAGGTTTGAAGGATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-395s1c1
Sequence:CCGGCGGGCCTATGATTATGTGGAACTCGAGTTCCACATAATCATAGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008222.2-1690s1c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-587s21c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-1750s21c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-349s21c1
Sequence:CCGGTCAGGATGCCCGATGCATAAACTCGAGTTTATGCATCGGGCATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-827s21c1
Sequence:CCGGTGGTCCGATTTGGAGGTAAAGCTCGAGCTTTACCTCCAAATCGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008222
VALIDATED
HCCS MISSION shRNA shRNA Plasmid DNA
holocytochrome c synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-851s21c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-525s1c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-789s1c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-454s1c2
Sequence:CCGGCCTCGATCCTTCAAACCTGATCTCGAGATCAGGTTTGAAGGATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-395s1c1
Sequence:CCGGCGGGCCTATGATTATGTGGAACTCGAGTTCCACATAATCATAGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008222.2-1690s1c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-587s21c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-1750s21c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-349s21c1
Sequence:CCGGTCAGGATGCCCGATGCATAAACTCGAGTTTATGCATCGGGCATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-827s21c1
Sequence:CCGGTGGTCCGATTTGGAGGTAAAGCTCGAGCTTTACCTCCAAATCGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008222
VALIDATED
HCCS MISSION shRNA Lentiviral Transduction Particles
holocytochrome c synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-851s21c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-525s1c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-789s1c1
Sequence:CCGGGAGAGTATTCACCAAGAGCAACTCGAGTTGCTCTTGGTGAATACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-454s1c2
Sequence:CCGGCCTCGATCCTTCAAACCTGATCTCGAGATCAGGTTTGAAGGATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008222.2-395s1c1
Sequence:CCGGCGGGCCTATGATTATGTGGAACTCGAGTTCCACATAATCATAGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008222.2-1690s1c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-587s21c1
Sequence:CCGGCCTCAAGAGAGGAGTCATCAACTCGAGTTGATGACTCCTCTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-1750s21c1
Sequence:CCGGCCCTAGAAGATGACAAATTATCTCGAGATAATTTGTCATCTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-349s21c1
Sequence:CCGGTCAGGATGCCCGATGCATAAACTCGAGTTTATGCATCGGGCATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008222.4-827s21c1
Sequence:CCGGTGGTCCGATTTGGAGGTAAAGCTCGAGCTTTACCTCCAAATCGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005333
VALIDATED
HCCS MISSION shRNA Bacterial Glycerol Stock
holocytochrome c synthase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-772s1c1
Sequence:CCGGGTATTCACCAAGGGCACGAATCTCGAGATTCGTGCCCTTGGTGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-527s1c1
Sequence:CCGGCCGAGAGCAGATTCAGAGAAACTCGAGTTTCTCTGAATCTGCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-416s1c1
Sequence:CCGGGCTGAGAATAAGGAGAACCTACTCGAGTAGGTTCTCCTTATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-936s1c1
Sequence:CCGGGTCCTGCCTTAGATTCACTTTCTCGAGAAAGTGAATCTAAGGCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-494s1c1
Sequence:CCGGGCATTGTCTACTGTCAGAGAACTCGAGTTCTCTGACAGTAGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005333
VALIDATED
HCCS MISSION shRNA shRNA Plasmid DNA
holocytochrome c synthase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-772s1c1
Sequence:CCGGGTATTCACCAAGGGCACGAATCTCGAGATTCGTGCCCTTGGTGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-527s1c1
Sequence:CCGGCCGAGAGCAGATTCAGAGAAACTCGAGTTTCTCTGAATCTGCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-416s1c1
Sequence:CCGGGCTGAGAATAAGGAGAACCTACTCGAGTAGGTTCTCCTTATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-936s1c1
Sequence:CCGGGTCCTGCCTTAGATTCACTTTCTCGAGAAAGTGAATCTAAGGCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-494s1c1
Sequence:CCGGGCATTGTCTACTGTCAGAGAACTCGAGTTCTCTGACAGTAGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005333
VALIDATED
HCCS MISSION shRNA Lentiviral Transduction Particles
holocytochrome c synthase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-772s1c1
Sequence:CCGGGTATTCACCAAGGGCACGAATCTCGAGATTCGTGCCCTTGGTGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-527s1c1
Sequence:CCGGCCGAGAGCAGATTCAGAGAAACTCGAGTTTCTCTGAATCTGCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-416s1c1
Sequence:CCGGGCTGAGAATAAGGAGAACCTACTCGAGTAGGTTCTCCTTATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-936s1c1
Sequence:CCGGGTCCTGCCTTAGATTCACTTTCTCGAGAAAGTGAATCTAAGGCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005333.1-494s1c1
Sequence:CCGGGCATTGTCTACTGTCAGAGAACTCGAGTTCTCTGACAGTAGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)