EMAIL THIS PAGE TO A FRIEND

HCFC2

host cell factor C2

69 Gene Product Result for
Synonyms: HCF-2 HCF2
UniProtKB ID: Q9Y5Z7, B2R8Q5
Gene ID:
Human(29915) Summary: This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
Mouse(67933) host cell factor C2
Rat(314704) host cell factor C2
domestic guinea pig(100724052) host cell factor C2
naked mole-rat(101701605) host cell factor C2
sheep(101102055) host cell factor C2
Domestic Rabbit(100343128) host cell factor C2
Zebrafish(550401) host cell factor C2
cow(505341) host cell factor C2
domestic cat(101084553) host cell factor C2
dog(475449) host cell factor C2
chicken(418083) host cell factor C2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013320 Rosetta Predictions human pricing
NM_001008357 Rosetta Predictions rat pricing
NM_001081218 Rosetta Predictions mouse pricing
XM_001002437 Rosetta Predictions mouse pricing
XM_483931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107933 predicted 1502
2 SASI_Hs01_00107934 predicted 2276
3 SASI_Hs01_00107935 predicted 1998
4 SASI_Hs01_00107936 predicted 1523
5 SASI_Hs01_00107937 predicted 1514
6 SASI_Hs01_00107938 predicted 2289
7 SASI_Hs01_00107939 predicted 1234
8 SASI_Hs01_00107942 predicted 1372
9 SASI_Hs02_00344622 predicted 488
10 SASI_Hs02_00344623 predicted 1788
11 SASI_Hs01_00107940 predicted 473
12 SASI_Hs01_00107941 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084209 predicted 1281
2 SASI_Rn01_00084210 predicted 1923
3 SASI_Rn01_00084211 predicted 610
4 SASI_Rn02_00199119 predicted 1162
5 SASI_Rn01_00084212 predicted 239
6 SASI_Rn01_00084213 predicted 1412
7 SASI_Rn01_00084214 predicted 1659
8 SASI_Rn01_00084215 predicted 358
9 SASI_Rn01_00084216 predicted 384
10 SASI_Rn01_00084217 predicted 1679
11 SASI_Rn01_00084208 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296341 predicted 1412
2 SASI_Mm02_00296342 predicted 576
3 SASI_Mm02_00296343 predicted 440
4 SASI_Mm02_00296344 predicted 1817
5 SASI_Mm02_00296345 predicted 1892
6 SASI_Mm02_00296346 predicted 1322
7 SASI_Mm02_00296347 predicted 1963
8 SASI_Mm02_00296348 predicted 514
9 SASI_Mm02_00296349 predicted 1802
10 SASI_Mm02_00296350 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218691 predicted 1302
2 SASI_Mm01_00218692 predicted 1683
3 SASI_Mm01_00218693 predicted 1312
4 SASI_Mm01_00218694 predicted 1715
5 SASI_Mm01_00218695 predicted 1785
6 SASI_Mm01_00218696 predicted 1217
7 SASI_Mm01_00218697 predicted 1855
8 SASI_Mm01_00218698 predicted 1971
9 SASI_Mm01_00218699 predicted 1691
10 SASI_Mm01_00218700 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237572 predicted 1425
2 SASI_Mm01_00237573 predicted 1791
3 SASI_Mm01_00237574 predicted 449
4 SASI_Mm01_00237575 predicted 1821
5 SASI_Mm01_00237576 predicted 1897
6 SASI_Mm01_00237577 predicted 1331
7 SASI_Mm01_00237578 predicted 518
8 SASI_Mm01_00237579 predicted 717
9 SASI_Mm01_00237580 predicted 433
10 SASI_Mm01_00237581 predicted 2108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081218
HCFC2 MISSION shRNA Bacterial Glycerol Stock
host cell factor C2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000431007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-277s21c1
Sequence:CCGGACGAGCTGCACGTCTACAATACTCGAGTATTGTAGACGTGCAGCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-1586s21c1
Sequence:CCGGCAAGAATGAAGTTGATGAAATCTCGAGATTTCATCAACTTCATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-540s21c1
Sequence:CCGGTATGGTAACAAATGCTATTTGCTCGAGCAAATAGCATTTGTTACCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081218
HCFC2 MISSION shRNA shRNA Plasmid DNA
host cell factor C2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000431007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-277s21c1
Sequence:CCGGACGAGCTGCACGTCTACAATACTCGAGTATTGTAGACGTGCAGCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-1586s21c1
Sequence:CCGGCAAGAATGAAGTTGATGAAATCTCGAGATTTCATCAACTTCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-540s21c1
Sequence:CCGGTATGGTAACAAATGCTATTTGCTCGAGCAAATAGCATTTGTTACCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081218
HCFC2 MISSION shRNA Lentiviral Transduction Particles
host cell factor C2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000431007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-277s21c1
Sequence:CCGGACGAGCTGCACGTCTACAATACTCGAGTATTGTAGACGTGCAGCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-1586s21c1
Sequence:CCGGCAAGAATGAAGTTGATGAAATCTCGAGATTTCATCAACTTCATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081218.1-540s21c1
Sequence:CCGGTATGGTAACAAATGCTATTTGCTCGAGCAAATAGCATTTGTTACCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013320
VALIDATED
HCFC2 MISSION shRNA Bacterial Glycerol Stock
host cell factor C2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-345s21c1
Sequence:CCGGGTACCAGAATATTAGTATTTGCTCGAGCAAATACTAATATTCTGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-387s21c1
Sequence:CCGGGATACAGCAATGAGTTATATGCTCGAGCATATAACTCATTGCTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1673s21c1
Sequence:CCGGGTAACCCAGCAGACCATTAAACTCGAGTTTAATGGTCTGCTGGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013320.2-3127s21c1
Sequence:CCGGATTCTTACCAGGCCAATATATCTCGAGATATATTGGCCTGGTAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1374s21c1
Sequence:CCGGTCGTTCCTAACAGTATCAATGCTCGAGCATTGATACTGTTAGGAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2350s1c1
Sequence:CCGGCGGTGGCTTCAAGGTAACAATCTCGAGATTGTTACCTTGAAGCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-1114s1c1
Sequence:CCGGGCCACTACCAACTCCTTTCATCTCGAGATGAAAGGAGTTGGTAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2205s1c1
Sequence:CCGGGAGGATTTATTGTGGTCTTAACTCGAGTTAAGACCACAATAAATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-681s1c1
Sequence:CCGGGCAGCTTGACTTAGAAACTATCTCGAGATAGTTTCTAAGTCAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-195s1c1
Sequence:CCGGGCCAGCTGTTAGAGGAGATATCTCGAGATATCTCCTCTAACAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013320
VALIDATED
HCFC2 MISSION shRNA shRNA Plasmid DNA
host cell factor C2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-345s21c1
Sequence:CCGGGTACCAGAATATTAGTATTTGCTCGAGCAAATACTAATATTCTGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-387s21c1
Sequence:CCGGGATACAGCAATGAGTTATATGCTCGAGCATATAACTCATTGCTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1673s21c1
Sequence:CCGGGTAACCCAGCAGACCATTAAACTCGAGTTTAATGGTCTGCTGGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013320.2-3127s21c1
Sequence:CCGGATTCTTACCAGGCCAATATATCTCGAGATATATTGGCCTGGTAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1374s21c1
Sequence:CCGGTCGTTCCTAACAGTATCAATGCTCGAGCATTGATACTGTTAGGAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2350s1c1
Sequence:CCGGCGGTGGCTTCAAGGTAACAATCTCGAGATTGTTACCTTGAAGCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-1114s1c1
Sequence:CCGGGCCACTACCAACTCCTTTCATCTCGAGATGAAAGGAGTTGGTAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2205s1c1
Sequence:CCGGGAGGATTTATTGTGGTCTTAACTCGAGTTAAGACCACAATAAATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-681s1c1
Sequence:CCGGGCAGCTTGACTTAGAAACTATCTCGAGATAGTTTCTAAGTCAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-195s1c1
Sequence:CCGGGCCAGCTGTTAGAGGAGATATCTCGAGATATCTCCTCTAACAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013320
VALIDATED
HCFC2 MISSION shRNA Lentiviral Transduction Particles
host cell factor C2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-345s21c1
Sequence:CCGGGTACCAGAATATTAGTATTTGCTCGAGCAAATACTAATATTCTGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-387s21c1
Sequence:CCGGGATACAGCAATGAGTTATATGCTCGAGCATATAACTCATTGCTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1673s21c1
Sequence:CCGGGTAACCCAGCAGACCATTAAACTCGAGTTTAATGGTCTGCTGGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013320.2-3127s21c1
Sequence:CCGGATTCTTACCAGGCCAATATATCTCGAGATATATTGGCCTGGTAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013320.2-1374s21c1
Sequence:CCGGTCGTTCCTAACAGTATCAATGCTCGAGCATTGATACTGTTAGGAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2350s1c1
Sequence:CCGGCGGTGGCTTCAAGGTAACAATCTCGAGATTGTTACCTTGAAGCCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-1114s1c1
Sequence:CCGGGCCACTACCAACTCCTTTCATCTCGAGATGAAAGGAGTTGGTAGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013320.1-2205s1c1
Sequence:CCGGGAGGATTTATTGTGGTCTTAACTCGAGTTAAGACCACAATAAATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-681s1c1
Sequence:CCGGGCAGCTTGACTTAGAAACTATCTCGAGATAGTTTCTAAGTCAAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013320.1-195s1c1
Sequence:CCGGGCCAGCTGTTAGAGGAGATATCTCGAGATATCTCCTCTAACAGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026462
VALIDATED
HCFC2 MISSION shRNA Bacterial Glycerol Stock
host cell factor C2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026462.1-103s1c1
Sequence:CCGGGCAACTAAGATCAGCCGTGTACTCGAGTACACGGCTGATCTTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-303s1c1
Sequence:CCGGGCCTGACTACAGTTTGCTTAACTCGAGTTAAGCAAACTGTAGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-394s1c1
Sequence:CCGGCCTCTCAGTAAAGTCAGTGAACTCGAGTTCACTGACTTTACTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-196s1c1
Sequence:CCGGCAGTGGTGTGATGTGGGAATTCTCGAGAATTCCCACATCACACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-693s1c1
Sequence:CCGGGTTCAGAATATCCGCAAAGAACTCGAGTTCTTTGCGGATATTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026462
VALIDATED
HCFC2 MISSION shRNA shRNA Plasmid DNA
host cell factor C2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026462.1-103s1c1
Sequence:CCGGGCAACTAAGATCAGCCGTGTACTCGAGTACACGGCTGATCTTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-303s1c1
Sequence:CCGGGCCTGACTACAGTTTGCTTAACTCGAGTTAAGCAAACTGTAGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-394s1c1
Sequence:CCGGCCTCTCAGTAAAGTCAGTGAACTCGAGTTCACTGACTTTACTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-196s1c1
Sequence:CCGGCAGTGGTGTGATGTGGGAATTCTCGAGAATTCCCACATCACACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-693s1c1
Sequence:CCGGGTTCAGAATATCCGCAAAGAACTCGAGTTCTTTGCGGATATTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026462
VALIDATED
HCFC2 MISSION shRNA Lentiviral Transduction Particles
host cell factor C2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026462.1-103s1c1
Sequence:CCGGGCAACTAAGATCAGCCGTGTACTCGAGTACACGGCTGATCTTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-303s1c1
Sequence:CCGGGCCTGACTACAGTTTGCTTAACTCGAGTTAAGCAAACTGTAGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-394s1c1
Sequence:CCGGCCTCTCAGTAAAGTCAGTGAACTCGAGTTCACTGACTTTACTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-196s1c1
Sequence:CCGGCAGTGGTGTGATGTGGGAATTCTCGAGAATTCCCACATCACACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026462.1-693s1c1
Sequence:CCGGGTTCAGAATATCCGCAAAGAACTCGAGTTCTTTGCGGATATTCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)