EMAIL THIS PAGE TO A FRIEND

HCG9

HLA complex group 9 (non-protein coding)

13 Gene Product Result for
Synonyms: HCGIX HCGIX4
Species: Human HCG9(10255)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005844 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106418 predicted 212
2 SASI_Hs01_00106419 predicted 240
3 SASI_Hs01_00106420 predicted 200
4 SASI_Hs01_00106421 predicted 195
5 SASI_Hs01_00106422 predicted 221
6 SASI_Hs01_00106423 predicted 311
7 SASI_Hs01_00106424 predicted 415
8 SASI_Hs01_00106425 predicted 397
9 SASI_Hs01_00106426 predicted 402
10 SASI_Hs01_00106427 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005844
HCG9 MISSION shRNA Bacterial Glycerol Stock
HLA complex group 9 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-430s21c1
Sequence:CCGGCATGAGCTTCTACCTCCAGATCTCGAGATCTGGAGGTAGAAGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-409s21c1
Sequence:CCGGGCGAGGTCAAGCTGCAGAGAACTCGAGTTCTCTGCAGCTTGACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-421s21c1
Sequence:CCGGTGCAGAGAACATGAGCTTCTACTCGAGTAGAAGCTCATGTTCTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-462s21c1
Sequence:CCGGCATCTCAATAAACTTGGATTTCTCGAGAAATCCAAGTTTATTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-453s21c1
Sequence:CCGGGCCAGGGTGCATCTCAATAAACTCGAGTTTATTGAGATGCACCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005844
HCG9 MISSION shRNA shRNA Plasmid DNA
HLA complex group 9 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-430s21c1
Sequence:CCGGCATGAGCTTCTACCTCCAGATCTCGAGATCTGGAGGTAGAAGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-409s21c1
Sequence:CCGGGCGAGGTCAAGCTGCAGAGAACTCGAGTTCTCTGCAGCTTGACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-421s21c1
Sequence:CCGGTGCAGAGAACATGAGCTTCTACTCGAGTAGAAGCTCATGTTCTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-462s21c1
Sequence:CCGGCATCTCAATAAACTTGGATTTCTCGAGAAATCCAAGTTTATTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-453s21c1
Sequence:CCGGGCCAGGGTGCATCTCAATAAACTCGAGTTTATTGAGATGCACCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005844
HCG9 MISSION shRNA Lentiviral Transduction Particles
HLA complex group 9 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-430s21c1
Sequence:CCGGCATGAGCTTCTACCTCCAGATCTCGAGATCTGGAGGTAGAAGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-409s21c1
Sequence:CCGGGCGAGGTCAAGCTGCAGAGAACTCGAGTTCTCTGCAGCTTGACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-421s21c1
Sequence:CCGGTGCAGAGAACATGAGCTTCTACTCGAGTAGAAGCTCATGTTCTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-462s21c1
Sequence:CCGGCATCTCAATAAACTTGGATTTCTCGAGAAATCCAAGTTTATTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005844.2-453s21c1
Sequence:CCGGGCCAGGGTGCATCTCAATAAACTCGAGTTTATTGAGATGCACCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)