EMAIL THIS PAGE TO A FRIEND

HCK

hemopoietic cell kinase

73 Gene Product Result for
Synonyms: JTK9 p59Hck p61Hck
Gene ID:
Human(3055) Summary: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]
Mouse(15162) hemopoietic cell kinase
Rat(25734) hemopoietic cell kinase
sheep(101113167) hemopoietic cell kinase
domestic guinea pig(100714976) hemopoietic cell kinase
naked mole-rat(101709222) hemopoietic cell kinase
chicken(419280) hemopoietic cell kinase
dog(485828) hemopoietic cell kinase
domestic cat(101101207) hemopoietic cell kinase
cow(280814) hemopoietic cell kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0966 Phosphotyrosine HCK / Tyrosine-protein Kinase HCK ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002110 Rosetta Predictions human pricing
NM_013185 Rosetta Predictions rat pricing
NM_010407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154022 predicted 1331
2 SASI_Hs01_00154023 predicted 663
3 SASI_Hs01_00154024 predicted 1397
4 SASI_Hs01_00154025 predicted 328
5 SASI_Hs01_00154026 predicted 1532
6 SASI_Hs02_00333226 predicted 743
7 SASI_Hs01_00154027 predicted 1055
8 SASI_Hs01_00154028 predicted 680
9 SASI_Hs01_00154029 predicted 1242
10 SASI_Hs01_00154030 predicted 1567
11 SASI_Hs01_00154021 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121992 predicted 498
2 SASI_Rn01_00121993 predicted 649
3 SASI_Rn01_00121994 predicted 342
4 SASI_Rn01_00121995 predicted 1268
5 SASI_Rn01_00121996 predicted 381
6 SASI_Rn01_00121997 predicted 1187
7 SASI_Rn01_00121998 predicted 1541
8 SASI_Rn01_00121999 predicted 491
9 SASI_Rn01_00122000 predicted 1130
10 SASI_Rn01_00122001 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104499 predicted 558
2 SASI_Mm01_00104500 predicted 657
3 SASI_Mm01_00104501 predicted 540
4 SASI_Mm01_00104502 predicted 921
5 SASI_Mm01_00104503 predicted 950
6 SASI_Mm01_00104504 predicted 1453
7 SASI_Mm01_00104505 predicted 1373
8 SASI_Mm01_00104506 predicted 1352
9 SASI_Mm01_00104507 predicted 457
10 SASI_Mm01_00104508 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002110
VALIDATED
HCK MISSION shRNA Bacterial Glycerol Stock
hemopoietic cell kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1285s21c1
Sequence:GTACCGGATCGAGCAGAGGAACTACATCCTCGAGGATGTAGTTCCTCTGCTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-1247s21c1
Sequence:GTACCGGTTGACTTCTCAGCCCAGATTGCTCGAGCAATCTGGGCTGAGAAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1352s21c1
Sequence:CCGGTGTGTAAGATTGCTGACTTTGCTCGAGCAAAGTCAGCAATCTTACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-744s21c1
Sequence:GTACCGGGGGAGATACCGTGAAACATTACTCGAGTAATGTTTCACGGTATCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-261s21c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-417s21c1
Sequence:CCGGCGTGGTTGCCCTGTATGATTACTCGAGTAATCATACAGGGCAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1735s21c1
Sequence:CCGGTACCAACAGCAGCCATGATAGCTCGAGCTATCATGGCTGCTGTTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1930s21c1
Sequence:CCGGGCAATCCACAATCTGACATTCCTCGAGGAATGTCAGATTGTGGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-1122s1c1
Sequence:CCGGGGTCAAACTTCATGCGGTGGTCTCGAGACCACCGCATGAAGTTTGACCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-412s1c1
Sequence:CCGGATCATCGTGGTTGCCCTGTATCTCGAGATACAGGGCAACCACGATGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-742s1c1
Sequence:CCGGCAGGGAGATACCGTGAAACATCTCGAGATGTTTCACGGTATCTCCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-369s1c1
Sequence:CCGGCAACAGCAACACACCAGGAATCTCGAGATTCCTGGTGTGTTGCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002110.x-261s1c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002110.2-1510s1c1
Sequence:CCGGCTGATGGAGATCGTCACCTACCTCGAGGTAGGTGACGATCTCCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002110.2-1938s1c1
Sequence:CCGGCAATCTGACATTCTCAGGAAGCTCGAGCTTCCTGAGAATGTCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002110
VALIDATED
HCK MISSION shRNA shRNA Plasmid DNA
hemopoietic cell kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1285s21c1
Sequence:GTACCGGATCGAGCAGAGGAACTACATCCTCGAGGATGTAGTTCCTCTGCTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-1247s21c1
Sequence:GTACCGGTTGACTTCTCAGCCCAGATTGCTCGAGCAATCTGGGCTGAGAAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1352s21c1
Sequence:CCGGTGTGTAAGATTGCTGACTTTGCTCGAGCAAAGTCAGCAATCTTACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-744s21c1
Sequence:GTACCGGGGGAGATACCGTGAAACATTACTCGAGTAATGTTTCACGGTATCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-261s21c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-417s21c1
Sequence:CCGGCGTGGTTGCCCTGTATGATTACTCGAGTAATCATACAGGGCAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1735s21c1
Sequence:CCGGTACCAACAGCAGCCATGATAGCTCGAGCTATCATGGCTGCTGTTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1930s21c1
Sequence:CCGGGCAATCCACAATCTGACATTCCTCGAGGAATGTCAGATTGTGGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-1122s1c1
Sequence:CCGGGGTCAAACTTCATGCGGTGGTCTCGAGACCACCGCATGAAGTTTGACCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-412s1c1
Sequence:CCGGATCATCGTGGTTGCCCTGTATCTCGAGATACAGGGCAACCACGATGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-742s1c1
Sequence:CCGGCAGGGAGATACCGTGAAACATCTCGAGATGTTTCACGGTATCTCCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-369s1c1
Sequence:CCGGCAACAGCAACACACCAGGAATCTCGAGATTCCTGGTGTGTTGCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002110.x-261s1c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002110.2-1510s1c1
Sequence:CCGGCTGATGGAGATCGTCACCTACCTCGAGGTAGGTGACGATCTCCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002110.2-1938s1c1
Sequence:CCGGCAATCTGACATTCTCAGGAAGCTCGAGCTTCCTGAGAATGTCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002110
VALIDATED
HCK MISSION shRNA Lentiviral Transduction Particles
hemopoietic cell kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1285s21c1
Sequence:GTACCGGATCGAGCAGAGGAACTACATCCTCGAGGATGTAGTTCCTCTGCTCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-1247s21c1
Sequence:GTACCGGTTGACTTCTCAGCCCAGATTGCTCGAGCAATCTGGGCTGAGAAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1352s21c1
Sequence:CCGGTGTGTAAGATTGCTGACTTTGCTCGAGCAAAGTCAGCAATCTTACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-744s21c1
Sequence:GTACCGGGGGAGATACCGTGAAACATTACTCGAGTAATGTTTCACGGTATCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002110.2-261s21c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-417s21c1
Sequence:CCGGCGTGGTTGCCCTGTATGATTACTCGAGTAATCATACAGGGCAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1735s21c1
Sequence:CCGGTACCAACAGCAGCCATGATAGCTCGAGCTATCATGGCTGCTGTTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002110.2-1930s21c1
Sequence:CCGGGCAATCCACAATCTGACATTCCTCGAGGAATGTCAGATTGTGGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-1122s1c1
Sequence:CCGGGGTCAAACTTCATGCGGTGGTCTCGAGACCACCGCATGAAGTTTGACCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-412s1c1
Sequence:CCGGATCATCGTGGTTGCCCTGTATCTCGAGATACAGGGCAACCACGATGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-742s1c1
Sequence:CCGGCAGGGAGATACCGTGAAACATCTCGAGATGTTTCACGGTATCTCCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002110.x-369s1c1
Sequence:CCGGCAACAGCAACACACCAGGAATCTCGAGATTCCTGGTGTGTTGCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002110.x-261s1c1
Sequence:CCGGCCAGGTCGGAGGCAATACATTCTCGAGAATGTATTGCCTCCGACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002110.2-1510s1c1
Sequence:CCGGCTGATGGAGATCGTCACCTACCTCGAGGTAGGTGACGATCTCCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002110.2-1938s1c1
Sequence:CCGGCAATCTGACATTCTCAGGAAGCTCGAGCTTCCTGAGAATGTCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010407
HCK MISSION shRNA Bacterial Glycerol Stock
hemopoietic cell kinase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1601s21c1
Sequence:CCGGCCGTATGCCTCGACCAGATAACTCGAGTTATCTGGTCGAGGCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-756s21c1
Sequence:CCGGGACACCGTGAAGCACTATAAGCTCGAGCTTATAGTGCTTCACGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1453s21c1
Sequence:CCGGCTCCTGAAGCCATCAACTTTGCTCGAGCAAAGTTGATGGCTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1017s1c1
Sequence:CCGGACCTACAACAAGCACACCAAACTCGAGTTTGGTGTGCTTGTTGTAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1350s1c1
Sequence:CCGGGCATCACTGGTGTGTAAGATTCTCGAGAATCTTACACACCAGTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1386s1c1
Sequence:CCGGGCACGAATCATCGAGGACAATCTCGAGATTGTCCTCGATGATTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-435s1c1
Sequence:CCGGCTGTACGACTATGAGGCTATTCTCGAGAATAGCCTCATAGTCGTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010407
HCK MISSION shRNA shRNA Plasmid DNA
hemopoietic cell kinase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1601s21c1
Sequence:CCGGCCGTATGCCTCGACCAGATAACTCGAGTTATCTGGTCGAGGCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-756s21c1
Sequence:CCGGGACACCGTGAAGCACTATAAGCTCGAGCTTATAGTGCTTCACGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1453s21c1
Sequence:CCGGCTCCTGAAGCCATCAACTTTGCTCGAGCAAAGTTGATGGCTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1017s1c1
Sequence:CCGGACCTACAACAAGCACACCAAACTCGAGTTTGGTGTGCTTGTTGTAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1350s1c1
Sequence:CCGGGCATCACTGGTGTGTAAGATTCTCGAGAATCTTACACACCAGTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1386s1c1
Sequence:CCGGGCACGAATCATCGAGGACAATCTCGAGATTGTCCTCGATGATTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-435s1c1
Sequence:CCGGCTGTACGACTATGAGGCTATTCTCGAGAATAGCCTCATAGTCGTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010407
HCK MISSION shRNA Lentiviral Transduction Particles
hemopoietic cell kinase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1601s21c1
Sequence:CCGGCCGTATGCCTCGACCAGATAACTCGAGTTATCTGGTCGAGGCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-756s21c1
Sequence:CCGGGACACCGTGAAGCACTATAAGCTCGAGCTTATAGTGCTTCACGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010407.3-1453s21c1
Sequence:CCGGCTCCTGAAGCCATCAACTTTGCTCGAGCAAAGTTGATGGCTTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1017s1c1
Sequence:CCGGACCTACAACAAGCACACCAAACTCGAGTTTGGTGTGCTTGTTGTAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1350s1c1
Sequence:CCGGGCATCACTGGTGTGTAAGATTCTCGAGAATCTTACACACCAGTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-1386s1c1
Sequence:CCGGGCACGAATCATCGAGGACAATCTCGAGATTGTCCTCGATGATTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010407.3-435s1c1
Sequence:CCGGCTGTACGACTATGAGGCTATTCTCGAGAATAGCCTCATAGTCGTACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)