EMAIL THIS PAGE TO A FRIEND

HCLS1

hematopoietic cell-specific Lyn substrate 1

68 Gene Product Result for
Synonyms: CTTNL HS1
UniProtKB ID: P14317, Q53Y93, Q6IBK9, Q9UDK0
Gene ID:
Mouse(15163) hematopoietic cell specific Lyn substrate 1
Rat(288077) hematopoietic cell specific Lyn substrate 1
Zebrafish(563056) hematopoietic cell-specific Lyn substrate 1
chicken(426867) hematopoietic cell-specific Lyn substrate 1
cow(508445) hematopoietic cell-specific Lyn substrate 1
Horse(100060842) hematopoietic cell-specific Lyn substrate 1
domestic cat(101084469) hematopoietic cell-specific Lyn substrate 1
dog(100684969) hematopoietic cell-specific Lyn substrate 1
domestic guinea pig(100717270) hematopoietic cell-specific Lyn substrate 1
naked mole-rat(101723153) hematopoietic cell-specific Lyn substrate 1
sheep(101110196) hematopoietic cell-specific Lyn substrate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048281 MISSION® esiRNA esiRNA human HCLS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005335 Rosetta Predictions human pricing
NM_001011898 Rosetta Predictions rat pricing
XM_573292 Rosetta Predictions rat pricing
NM_008225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203891 predicted 685
2 SASI_Hs01_00203892 predicted 700
3 SASI_Hs01_00203893 predicted 519
4 SASI_Hs01_00203896 predicted 623
5 SASI_Hs01_00203895 predicted 798
6 SASI_Hs02_00339403 predicted 1655
7 SASI_Hs01_00203897 predicted 367
8 SASI_Hs02_00339404 predicted 559
9 SASI_Hs01_00203898 predicted 392
10 SASI_Hs01_00203899 predicted 622
11 SASI_Hs01_00203894 predicted 490
12 SASI_Hs01_00203900 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065665 predicted 1290
2 SASI_Rn01_00065666 predicted 825
3 SASI_Rn01_00065667 predicted 708
4 SASI_Rn01_00065668 predicted 1331
5 SASI_Rn01_00065669 predicted 911
6 SASI_Rn01_00065670 predicted 1374
7 SASI_Rn01_00065671 predicted 250
8 SASI_Rn01_00065672 predicted 1200
9 SASI_Rn01_00065673 predicted 534
10 SASI_Rn01_00065674 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181945 predicted 1318
2 SASI_Rn01_00181946 predicted 861
3 SASI_Rn01_00181947 predicted 745
4 SASI_Rn01_00181948 predicted 1362
5 SASI_Rn01_00181949 predicted 940
6 SASI_Rn01_00181950 predicted 1402
7 SASI_Rn01_00181951 predicted 289
8 SASI_Rn01_00181952 predicted 1238
9 SASI_Rn01_00181953 predicted 562
10 SASI_Rn01_00181954 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313414 predicted 652
2 SASI_Mm01_00081320 predicted 736
3 SASI_Mm01_00081321 predicted 709
4 SASI_Mm01_00081323 predicted 1362
5 SASI_Mm01_00081324 predicted 1008
6 SASI_Mm01_00081326 predicted 638
7 SASI_Mm01_00081327 predicted 644
8 SASI_Mm02_00313415 predicted 1352
9 SASI_Mm01_00081328 predicted 574
10 SASI_Mm01_00081329 predicted 468
11 SASI_Mm01_00081322 predicted 1397
12 SASI_Mm01_00081325 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008225
HCLS1 MISSION shRNA Bacterial Glycerol Stock
hematopoietic cell-specific Lyn substrate 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008225.1-1649s1c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-550s1c1
Sequence:CCGGGAGAAGGATAAACGGGACAAACTCGAGTTTGTCCCGTTTATCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-1366s1c1
Sequence:CCGGGCCCTGTATGATTACCAAGGACTCGAGTCCTTGGTAATCATACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-132s1c1
Sequence:CCGGCCCTGACTTTGTGAATGACATCTCGAGATGTCATTCACAAAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-716s1c1
Sequence:CCGGCCACGGCGTATAAGAAGACAACTCGAGTTGTCTTCTTATACGCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-859s21c1
Sequence:CCGGGAGCGAAAGGCTGTGGTAAAGCTCGAGCTTTACCACAGCCTTTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-635s21c1
Sequence:CCGGAGGGCTTTGGTGGCCAATATGCTCGAGCATATTGGCCACCAAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008225.1-1649s21c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-1359s21c1
Sequence:CCGGTGCTATAGCCCTGTATGATTACTCGAGTAATCATACAGGGCTATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-302s21c1
Sequence:CCGGATGGCTATGGCGGTCAGTTTGCTCGAGCAAACTGACCGCCATAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008225
HCLS1 MISSION shRNA shRNA Plasmid DNA
hematopoietic cell-specific Lyn substrate 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008225.1-1649s1c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-550s1c1
Sequence:CCGGGAGAAGGATAAACGGGACAAACTCGAGTTTGTCCCGTTTATCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-1366s1c1
Sequence:CCGGGCCCTGTATGATTACCAAGGACTCGAGTCCTTGGTAATCATACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-132s1c1
Sequence:CCGGCCCTGACTTTGTGAATGACATCTCGAGATGTCATTCACAAAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-716s1c1
Sequence:CCGGCCACGGCGTATAAGAAGACAACTCGAGTTGTCTTCTTATACGCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-859s21c1
Sequence:CCGGGAGCGAAAGGCTGTGGTAAAGCTCGAGCTTTACCACAGCCTTTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-635s21c1
Sequence:CCGGAGGGCTTTGGTGGCCAATATGCTCGAGCATATTGGCCACCAAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008225.1-1649s21c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-1359s21c1
Sequence:CCGGTGCTATAGCCCTGTATGATTACTCGAGTAATCATACAGGGCTATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-302s21c1
Sequence:CCGGATGGCTATGGCGGTCAGTTTGCTCGAGCAAACTGACCGCCATAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008225
HCLS1 MISSION shRNA Lentiviral Transduction Particles
hematopoietic cell-specific Lyn substrate 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008225.1-1649s1c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-550s1c1
Sequence:CCGGGAGAAGGATAAACGGGACAAACTCGAGTTTGTCCCGTTTATCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-1366s1c1
Sequence:CCGGGCCCTGTATGATTACCAAGGACTCGAGTCCTTGGTAATCATACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-132s1c1
Sequence:CCGGCCCTGACTTTGTGAATGACATCTCGAGATGTCATTCACAAAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008225.1-716s1c1
Sequence:CCGGCCACGGCGTATAAGAAGACAACTCGAGTTGTCTTCTTATACGCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-859s21c1
Sequence:CCGGGAGCGAAAGGCTGTGGTAAAGCTCGAGCTTTACCACAGCCTTTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-635s21c1
Sequence:CCGGAGGGCTTTGGTGGCCAATATGCTCGAGCATATTGGCCACCAAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008225.1-1649s21c1
Sequence:CCGGCCCGCCTCTTTAAGAGCTTTACTCGAGTAAAGCTCTTAAAGAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-1359s21c1
Sequence:CCGGTGCTATAGCCCTGTATGATTACTCGAGTAATCATACAGGGCTATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008225.1-302s21c1
Sequence:CCGGATGGCTATGGCGGTCAGTTTGCTCGAGCAAACTGACCGCCATAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005335
VALIDATED
HCLS1 MISSION shRNA Bacterial Glycerol Stock
hematopoietic cell-specific Lyn substrate 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1573s1c1
Sequence:CCGGCCTCCCTATTCCTGATGCAAACTCGAGTTTGCATCAGGAATAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-300s1c1
Sequence:CCGGGAGGTCGGTTTGGAGTAGAAACTCGAGTTTCTACTCCAAACCGACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1481s1c1
Sequence:CCGGCCTGCAAATTATGTCAAGCTTCTCGAGAAGCTTGACATAATTTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-726s1c1
Sequence:CCGGCGCCCATAGAAGCCGCTTCTACTCGAGTAGAAGCGGCTTCTATGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1403s1c1
Sequence:CCGGGACGACGTAATCACTGACATTCTCGAGAATGTCAGTGATTACGTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1417s21c1
Sequence:CCGGTCTCAGCTGTGGCTCTATATGCTCGAGCATATAGAGCCACAGCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005335.4-1699s21c1
Sequence:CCGGTTCCCTCTCCTGCTTCATTAACTCGAGTTAATGAAGCAGGAGAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-528s21c1
Sequence:GTACCGGGCAGTCGGCTTTGATTATAAACTCGAGTTTATAATCAAAGCCGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1470s21c1
Sequence:CCGGTTTGATCCGGACGACGTAATCCTCGAGGATTACGTCGTCCGGATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-831s21c1
Sequence:CCGGCGTGGGCTGAAGGCGAAATTTCTCGAGAAATTTCGCCTTCAGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005335
VALIDATED
HCLS1 MISSION shRNA shRNA Plasmid DNA
hematopoietic cell-specific Lyn substrate 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1573s1c1
Sequence:CCGGCCTCCCTATTCCTGATGCAAACTCGAGTTTGCATCAGGAATAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-300s1c1
Sequence:CCGGGAGGTCGGTTTGGAGTAGAAACTCGAGTTTCTACTCCAAACCGACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1481s1c1
Sequence:CCGGCCTGCAAATTATGTCAAGCTTCTCGAGAAGCTTGACATAATTTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-726s1c1
Sequence:CCGGCGCCCATAGAAGCCGCTTCTACTCGAGTAGAAGCGGCTTCTATGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1403s1c1
Sequence:CCGGGACGACGTAATCACTGACATTCTCGAGAATGTCAGTGATTACGTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1417s21c1
Sequence:CCGGTCTCAGCTGTGGCTCTATATGCTCGAGCATATAGAGCCACAGCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005335.4-1699s21c1
Sequence:CCGGTTCCCTCTCCTGCTTCATTAACTCGAGTTAATGAAGCAGGAGAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-528s21c1
Sequence:GTACCGGGCAGTCGGCTTTGATTATAAACTCGAGTTTATAATCAAAGCCGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1470s21c1
Sequence:CCGGTTTGATCCGGACGACGTAATCCTCGAGGATTACGTCGTCCGGATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-831s21c1
Sequence:CCGGCGTGGGCTGAAGGCGAAATTTCTCGAGAAATTTCGCCTTCAGCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005335
VALIDATED
HCLS1 MISSION shRNA Lentiviral Transduction Particles
hematopoietic cell-specific Lyn substrate 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1573s1c1
Sequence:CCGGCCTCCCTATTCCTGATGCAAACTCGAGTTTGCATCAGGAATAGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-300s1c1
Sequence:CCGGGAGGTCGGTTTGGAGTAGAAACTCGAGTTTCTACTCCAAACCGACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1481s1c1
Sequence:CCGGCCTGCAAATTATGTCAAGCTTCTCGAGAAGCTTGACATAATTTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-726s1c1
Sequence:CCGGCGCCCATAGAAGCCGCTTCTACTCGAGTAGAAGCGGCTTCTATGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005335.3-1403s1c1
Sequence:CCGGGACGACGTAATCACTGACATTCTCGAGAATGTCAGTGATTACGTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1417s21c1
Sequence:CCGGTCTCAGCTGTGGCTCTATATGCTCGAGCATATAGAGCCACAGCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005335.4-1699s21c1
Sequence:CCGGTTCCCTCTCCTGCTTCATTAACTCGAGTTAATGAAGCAGGAGAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-528s21c1
Sequence:GTACCGGGCAGTCGGCTTTGATTATAAACTCGAGTTTATAATCAAAGCCGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-1470s21c1
Sequence:CCGGTTTGATCCGGACGACGTAATCCTCGAGGATTACGTCGTCCGGATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005335.4-831s21c1
Sequence:CCGGCGTGGGCTGAAGGCGAAATTTCTCGAGAAATTTCGCCTTCAGCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)