EMAIL THIS PAGE TO A FRIEND

HCN1

hyperpolarization activated cyclic nucleotide-gated potassium channel 1

206 Gene Product Result for
Synonyms: BCNG-1 BCNG1 HAC-2
UniProtKB ID: O60741
Gene ID:
Human(348980) Summary: The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
Mouse(15165) hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Rat(84390) hyperpolarization-activated cyclic nucleotide-gated potassium channel 1
sheep(101115314) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Domestic Rabbit(100008732) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
domestic guinea pig(100732018) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
naked mole-rat(101705902) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
chicken(431590) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
cow(538255) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Horse(100064345) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
domestic cat(101092001) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
dog(612434) hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021072 Rosetta Predictions human pricing
NM_053375 Rosetta Predictions rat pricing
NM_010408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107431 predicted 1139
2 SASI_Hs02_00354551 predicted 494
3 SASI_Hs02_00354552 predicted 1958
4 SASI_Hs01_00107430 predicted 1506
5 SASI_Hs01_00107435 predicted 1616
6 SASI_Hs01_00107436 predicted 472
7 SASI_Hs02_00354553 predicted 1552
8 SASI_Hs01_00107438 predicted 1747
9 SASI_Hs01_00107439 predicted 1941
10 SASI_Hs02_00354554 predicted 615
11 SASI_Hs01_00107432 predicted 515
12 SASI_Hs01_00107433 predicted 666
13 SASI_Hs01_00107434 predicted 1244
14 SASI_Hs01_00107437 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049516 predicted 483
2 SASI_Rn02_00265861 predicted 1383
3 SASI_Rn01_00049518 predicted 1943
4 SASI_Rn02_00265862 predicted 1766
5 SASI_Rn01_00049521 predicted 547
6 SASI_Rn01_00049522 predicted 1955
7 SASI_Rn01_00049523 predicted 1276
8 SASI_Rn01_00049524 predicted 307
9 SASI_Rn01_00049525 predicted 1064
10 SASI_Rn02_00265863 predicted 1792
11 SASI_Rn01_00049517 predicted 857
12 SASI_Rn01_00049519 predicted 1329
13 SASI_Rn01_00049520 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053387 predicted 601
2 SASI_Mm01_00053388 predicted 1882
3 SASI_Mm01_00053390 predicted 406
4 SASI_Mm01_00053391 predicted 1169
5 SASI_Mm02_00318542 predicted 1185
6 SASI_Mm02_00318543 predicted 453
7 SASI_Mm01_00053392 predicted 646
8 SASI_Mm02_00318544 predicted 1317
9 SASI_Mm01_00053394 predicted 1713
10 SASI_Mm01_00053395 predicted 1681
11 SASI_Mm01_00053389 predicted 1884
12 SASI_Mm01_00053393 predicted 1147
13 SASI_Mm01_00053396 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021072
HCN1 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021072.2-2744s21c1
Sequence:CCGGGACTATACTCAGATCTTATTTCTCGAGAAATAAGATCTGAGTATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-1453s21c1
Sequence:CCGGTGCTAATGCGGATCCTAATTTCTCGAGAAATTAGGATCCGCATTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-536s21c1
Sequence:CCGGACAACAACACCATGGATTATTCTCGAGAATAATCCATGGTGTTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1054s1c1
Sequence:CCGGGCAGTATTCATACGCACTCTTCTCGAGAAGAGTGCGTATGAATACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1688s1c1
Sequence:CCGGGCTGATACATATTGTCGTCTTCTCGAGAAGACGACAATATGTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-506s1c1
Sequence:CCGGCCAGTTGGAATCACATTCTTTCTCGAGAAAGAATGTGATTCCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1934s1c1
Sequence:CCGGGCTCCCATCAATTATCCTCAACTCGAGTTGAGGATAATTGATGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1238s1c1
Sequence:CCGGCGGCAGTATCAAGAGAAGTATCTCGAGATACTTCTCTTGATACTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021072
HCN1 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021072.2-2744s21c1
Sequence:CCGGGACTATACTCAGATCTTATTTCTCGAGAAATAAGATCTGAGTATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-1453s21c1
Sequence:CCGGTGCTAATGCGGATCCTAATTTCTCGAGAAATTAGGATCCGCATTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-536s21c1
Sequence:CCGGACAACAACACCATGGATTATTCTCGAGAATAATCCATGGTGTTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1054s1c1
Sequence:CCGGGCAGTATTCATACGCACTCTTCTCGAGAAGAGTGCGTATGAATACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1688s1c1
Sequence:CCGGGCTGATACATATTGTCGTCTTCTCGAGAAGACGACAATATGTATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-506s1c1
Sequence:CCGGCCAGTTGGAATCACATTCTTTCTCGAGAAAGAATGTGATTCCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1934s1c1
Sequence:CCGGGCTCCCATCAATTATCCTCAACTCGAGTTGAGGATAATTGATGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1238s1c1
Sequence:CCGGCGGCAGTATCAAGAGAAGTATCTCGAGATACTTCTCTTGATACTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021072
HCN1 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021072.2-2744s21c1
Sequence:CCGGGACTATACTCAGATCTTATTTCTCGAGAAATAAGATCTGAGTATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-1453s21c1
Sequence:CCGGTGCTAATGCGGATCCTAATTTCTCGAGAAATTAGGATCCGCATTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021072.2-536s21c1
Sequence:CCGGACAACAACACCATGGATTATTCTCGAGAATAATCCATGGTGTTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1054s1c1
Sequence:CCGGGCAGTATTCATACGCACTCTTCTCGAGAAGAGTGCGTATGAATACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1688s1c1
Sequence:CCGGGCTGATACATATTGTCGTCTTCTCGAGAAGACGACAATATGTATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-506s1c1
Sequence:CCGGCCAGTTGGAATCACATTCTTTCTCGAGAAAGAATGTGATTCCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1934s1c1
Sequence:CCGGGCTCCCATCAATTATCCTCAACTCGAGTTGAGGATAATTGATGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021072.1-1238s1c1
Sequence:CCGGCGGCAGTATCAAGAGAAGTATCTCGAGATACTTCTCTTGATACTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010408
HCN1 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010408.1-2862s1c1
Sequence:CCGGGTGGCCTACATGCAAATGTAACTCGAGTTACATTTGCATGTAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-957s1c1
Sequence:CCGGGCTGGGTTTCTCTGAATGAAACTCGAGTTTCATTCAGAGAAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-728s1c1
Sequence:CCGGGCACTTCGTATCGTGAGGTTTCTCGAGAAACCTCACGATACGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1252s1c1
Sequence:CCGGGCGCCAGAAGATACATGATTACTCGAGTAATCATGTATCTTCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1880s1c1
Sequence:CCGGCCTCCAATCAACTATCCTCAACTCGAGTTGAGGATAGTTGATTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010408
HCN1 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010408.1-2862s1c1
Sequence:CCGGGTGGCCTACATGCAAATGTAACTCGAGTTACATTTGCATGTAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-957s1c1
Sequence:CCGGGCTGGGTTTCTCTGAATGAAACTCGAGTTTCATTCAGAGAAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-728s1c1
Sequence:CCGGGCACTTCGTATCGTGAGGTTTCTCGAGAAACCTCACGATACGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1252s1c1
Sequence:CCGGGCGCCAGAAGATACATGATTACTCGAGTAATCATGTATCTTCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1880s1c1
Sequence:CCGGCCTCCAATCAACTATCCTCAACTCGAGTTGAGGATAGTTGATTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010408
HCN1 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010408.1-2862s1c1
Sequence:CCGGGTGGCCTACATGCAAATGTAACTCGAGTTACATTTGCATGTAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-957s1c1
Sequence:CCGGGCTGGGTTTCTCTGAATGAAACTCGAGTTTCATTCAGAGAAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-728s1c1
Sequence:CCGGGCACTTCGTATCGTGAGGTTTCTCGAGAAACCTCACGATACGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1252s1c1
Sequence:CCGGGCGCCAGAAGATACATGATTACTCGAGTAATCATGTATCTTCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010408.1-1880s1c1
Sequence:CCGGCCTCCAATCAACTATCCTCAACTCGAGTTGAGGATAGTTGATTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)