EMAIL THIS PAGE TO A FRIEND

HCN2

hyperpolarization activated cyclic nucleotide-gated potassium channel 2

62 Gene Product Result for
Synonyms: BCNG-2 BCNG2 HAC-1
UniProtKB ID: Q9UL51, O60742, O60743, O75267, Q9UBS2
Gene ID:
Human(610) Summary: Hyperpolarization-activated cation channels of the HCN gene family, such as HCN2, contribute to spontaneous rhythmic activity in both heart and brain.[supplied by OMIM, Jul 2010]
Mouse(15166) hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Rat(114244) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
chicken(770384) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
domestic cat(101090996) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
cow(100297361) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
dog(448791) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
domestic guinea pig(101787284) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
naked mole-rat(101722649) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
sheep(101108487) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Domestic Rabbit(100009468) hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502651 Anti-HCN2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
H2769 Anti-Hyperpolarization-Activated Cation Channel HCN2 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200025 Monoclonal Anti-HCN2 antibody produced in mouse clone S71-37, 1 mg/mL, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001194 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001194 Rosetta Predictions human pricing
NM_053684 Rosetta Predictions rat pricing
XM_001077248 Rosetta Predictions rat pricing
NM_008226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146972 predicted 1747
2 SASI_Hs01_00146973 predicted 1552
3 SASI_Hs01_00146974 predicted 1250
4 SASI_Hs01_00146975 predicted 979
5 SASI_Hs01_00146976 predicted 1542
6 SASI_Hs01_00146977 predicted 845
7 SASI_Hs01_00146978 predicted 1739
8 SASI_Hs01_00146979 predicted 1071
9 SASI_Hs01_00146980 predicted 1231
10 SASI_Hs01_00146981 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059049 predicted 918
2 SASI_Rn01_00059050 predicted 1444
3 SASI_Rn01_00059051 predicted 880
4 SASI_Rn01_00059052 predicted 811
5 SASI_Rn01_00059053 predicted 1656
6 SASI_Rn01_00059054 predicted 1731
7 SASI_Rn01_00059055 predicted 1338
8 SASI_Rn01_00059056 predicted 969
9 SASI_Rn01_00059057 predicted 1166
10 SASI_Rn01_00059058 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356363 predicted 1067
2 SASI_Rn02_00356364 predicted 507
3 SASI_Rn02_00356365 predicted 232
4 SASI_Rn02_00356366 predicted 1280
5 SASI_Rn02_00356367 predicted 370
6 SASI_Rn02_00356368 predicted 1359
7 SASI_Rn02_00356369 predicted 1064
8 SASI_Rn02_00356370 predicted 964
9 SASI_Rn02_00356371 predicted 1057
10 SASI_Rn02_00356372 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133913 predicted 1034
2 SASI_Mm01_00133914 predicted 878
3 SASI_Mm01_00133915 predicted 427
4 SASI_Mm01_00133916 predicted 961
5 SASI_Mm01_00133917 predicted 1443
6 SASI_Mm01_00133918 predicted 747
7 SASI_Mm01_00133919 predicted 1677
8 SASI_Mm01_00133920 predicted 1439
9 SASI_Mm01_00133921 predicted 1905
10 SASI_Mm01_00133922 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008226
HCN2 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008226.1-2927s1c1
Sequence:CCGGCCGAGGAAGAATATGGATCAACTCGAGTTGATCCATATTCTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-1618s1c1
Sequence:CCGGCCATGCTGACAAAGCTCAAATCTCGAGATTTGAGCTTTGTCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-748s1c1
Sequence:CCGGCCGGCATTGTTATTGAGGACACTCGAGTGTCCTCAATAACAATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-609s1c1
Sequence:CCGGCTGTTGTTCATGGTGGGAAATCTCGAGATTTCCCACCATGAACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-751s1c1
Sequence:CCGGGCATTGTTATTGAGGACAACACTCGAGTGTTGTCCTCAATAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008226
HCN2 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008226.1-2927s1c1
Sequence:CCGGCCGAGGAAGAATATGGATCAACTCGAGTTGATCCATATTCTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-1618s1c1
Sequence:CCGGCCATGCTGACAAAGCTCAAATCTCGAGATTTGAGCTTTGTCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-748s1c1
Sequence:CCGGCCGGCATTGTTATTGAGGACACTCGAGTGTCCTCAATAACAATGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-609s1c1
Sequence:CCGGCTGTTGTTCATGGTGGGAAATCTCGAGATTTCCCACCATGAACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-751s1c1
Sequence:CCGGGCATTGTTATTGAGGACAACACTCGAGTGTTGTCCTCAATAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008226
HCN2 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008226.1-2927s1c1
Sequence:CCGGCCGAGGAAGAATATGGATCAACTCGAGTTGATCCATATTCTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-1618s1c1
Sequence:CCGGCCATGCTGACAAAGCTCAAATCTCGAGATTTGAGCTTTGTCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-748s1c1
Sequence:CCGGCCGGCATTGTTATTGAGGACACTCGAGTGTCCTCAATAACAATGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-609s1c1
Sequence:CCGGCTGTTGTTCATGGTGGGAAATCTCGAGATTTCCCACCATGAACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008226.1-751s1c1
Sequence:CCGGGCATTGTTATTGAGGACAACACTCGAGTGTTGTCCTCAATAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001194
HCN2 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1151s1c1
Sequence:CCGGGATCTGCAATCTCATCAGCATCTCGAGATGCTGATGAGATTGCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-2096s1c1
Sequence:CCGGCGTATTCAACAACCAGGAGAACTCGAGTTCTCCTGGTTGTTGAATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1279s1c1
Sequence:CCGGCGTGGAGTGAACTGTACTCCTCTCGAGAGGAGTACAGTTCACTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1784s1c1
Sequence:CCGGCGGGAAGAAGATGTACTTCATCTCGAGATGAAGTACATCTTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-953s1c1
Sequence:CCGGCGTGGACTACATCTTCCTTATCTCGAGATAAGGAAGATGTAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001194.3-1079s21c1
Sequence:CCGGCCTGATCCGCTACATCCATCACTCGAGTGATGGATGTAGCGGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001194.3-3147s21c1
Sequence:CCGGCCCATCGCGCTCACGCAATAACTCGAGTTATTGCGTGAGCGCGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001194
HCN2 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1151s1c1
Sequence:CCGGGATCTGCAATCTCATCAGCATCTCGAGATGCTGATGAGATTGCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-2096s1c1
Sequence:CCGGCGTATTCAACAACCAGGAGAACTCGAGTTCTCCTGGTTGTTGAATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1279s1c1
Sequence:CCGGCGTGGAGTGAACTGTACTCCTCTCGAGAGGAGTACAGTTCACTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1784s1c1
Sequence:CCGGCGGGAAGAAGATGTACTTCATCTCGAGATGAAGTACATCTTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-953s1c1
Sequence:CCGGCGTGGACTACATCTTCCTTATCTCGAGATAAGGAAGATGTAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001194.3-1079s21c1
Sequence:CCGGCCTGATCCGCTACATCCATCACTCGAGTGATGGATGTAGCGGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001194.3-3147s21c1
Sequence:CCGGCCCATCGCGCTCACGCAATAACTCGAGTTATTGCGTGAGCGCGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001194
HCN2 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1151s1c1
Sequence:CCGGGATCTGCAATCTCATCAGCATCTCGAGATGCTGATGAGATTGCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-2096s1c1
Sequence:CCGGCGTATTCAACAACCAGGAGAACTCGAGTTCTCCTGGTTGTTGAATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1279s1c1
Sequence:CCGGCGTGGAGTGAACTGTACTCCTCTCGAGAGGAGTACAGTTCACTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-1784s1c1
Sequence:CCGGCGGGAAGAAGATGTACTTCATCTCGAGATGAAGTACATCTTCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001194.2-953s1c1
Sequence:CCGGCGTGGACTACATCTTCCTTATCTCGAGATAAGGAAGATGTAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001194.3-1079s21c1
Sequence:CCGGCCTGATCCGCTACATCCATCACTCGAGTGATGGATGTAGCGGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001194.3-3147s21c1
Sequence:CCGGCCCATCGCGCTCACGCAATAACTCGAGTTATTGCGTGAGCGCGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)