EMAIL THIS PAGE TO A FRIEND

HCN3

hyperpolarization activated cyclic nucleotide-gated potassium channel 3

57 Gene Product Result for
UniProtKB ID: Q9P1Z3, D3DV90, Q4VX12, Q8N6W6, Q9BWQ2
Gene ID:
Human(57657) Summary: This gene encodes a multi-pass membrane protein that functions as a voltage gated cation channel. The encoded protein is a member of a family of closely related cyclic adenosine monophosphate-binding channel proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(15168) hyperpolarization-activated, cyclic nucleotide-gated K+ 3
Rat(114245) hyperpolarization-activated cyclic nucleotide-gated potassium channel 3
Zebrafish(560709) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
domestic cat(101088717) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
cow(539578) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
dog(490426) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
sheep(101106647) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Domestic Rabbit(100008730) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
domestic guinea pig(100716480) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
naked mole-rat(101700183) hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020897 Rosetta Predictions human pricing
NM_053685 Rosetta Predictions rat pricing
NM_008227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214068 predicted 375
2 SASI_Hs01_00214069 predicted 781
3 SASI_Hs01_00214070 predicted 888
4 SASI_Hs01_00214072 predicted 2313
5 SASI_Hs01_00214073 predicted 1514
6 SASI_Hs01_00214074 predicted 405
7 SASI_Hs01_00214075 predicted 1477
8 SASI_Hs01_00214076 predicted 544
9 SASI_Hs02_00354220 predicted 1868
10 SASI_Hs02_00354221 predicted 582
11 SASI_Hs01_00214071 predicted 754
12 SASI_Hs01_00214077 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100682 predicted 479
2 SASI_Rn01_00100683 predicted 1502
3 SASI_Rn02_00266427 predicted 1171
4 SASI_Rn01_00100684 predicted 734
5 SASI_Rn01_00100685 predicted 453
6 SASI_Rn01_00100686 predicted 614
7 SASI_Rn01_00100687 predicted 1703
8 SASI_Rn01_00100689 predicted 1474
9 SASI_Rn01_00100691 predicted 835
10 SASI_Rn02_00266428 predicted 735
11 SASI_Rn01_00100688 predicted 846
12 SASI_Rn01_00100690 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131650 predicted 2524
2 SASI_Mm01_00131651 predicted 2517
3 SASI_Mm01_00131652 predicted 2449
4 SASI_Mm01_00131653 predicted 2431
5 SASI_Mm01_00131654 predicted 1681
6 SASI_Mm01_00131655 predicted 675
7 SASI_Mm01_00131656 predicted 1012
8 SASI_Mm01_00131657 predicted 2440
9 SASI_Mm02_00313416 predicted 2443
10 SASI_Mm01_00131658 predicted 1540
11 SASI_Mm01_00131649 predicted 2538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008227
HCN3 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008227.1-2759s1c1
Sequence:CCGGCCCTGCCTTTATTAAGCACAACTCGAGTTGTGCTTAATAAAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-428s1c1
Sequence:CCGGGCCTGTGGGTATCACTTTCTTCTCGAGAAGAAAGTGATACCCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-1670s1c1
Sequence:CCGGGCTTGAGGAGTTCCCAATGATCTCGAGATCATTGGGAACTCCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-716s1c1
Sequence:CCGGGCGCATCGTTAGATTCACCAACTCGAGTTGGTGAATCTAACGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-2416s1c1
Sequence:CCGGCCCAAATTTCTGCCAACATGTCTCGAGACATGTTGGCAGAAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008227
HCN3 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008227.1-2759s1c1
Sequence:CCGGCCCTGCCTTTATTAAGCACAACTCGAGTTGTGCTTAATAAAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-428s1c1
Sequence:CCGGGCCTGTGGGTATCACTTTCTTCTCGAGAAGAAAGTGATACCCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-1670s1c1
Sequence:CCGGGCTTGAGGAGTTCCCAATGATCTCGAGATCATTGGGAACTCCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-716s1c1
Sequence:CCGGGCGCATCGTTAGATTCACCAACTCGAGTTGGTGAATCTAACGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-2416s1c1
Sequence:CCGGCCCAAATTTCTGCCAACATGTCTCGAGACATGTTGGCAGAAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008227
HCN3 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008227.1-2759s1c1
Sequence:CCGGCCCTGCCTTTATTAAGCACAACTCGAGTTGTGCTTAATAAAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-428s1c1
Sequence:CCGGGCCTGTGGGTATCACTTTCTTCTCGAGAAGAAAGTGATACCCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-1670s1c1
Sequence:CCGGGCTTGAGGAGTTCCCAATGATCTCGAGATCATTGGGAACTCCTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-716s1c1
Sequence:CCGGGCGCATCGTTAGATTCACCAACTCGAGTTGGTGAATCTAACGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008227.1-2416s1c1
Sequence:CCGGCCCAAATTTCTGCCAACATGTCTCGAGACATGTTGGCAGAAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020897
HCN3 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-552s1c1
Sequence:CCGGCCTGTGGATTACATCTTCCTACTCGAGTAGGAAGATGTAATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-395s1c1
Sequence:CCGGCAACGTATTGTCTGATACTTTCTCGAGAAAGTATCAGACAATACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-753s1c1
Sequence:CCGGGTTCGCATCTTCAACCTCATTCTCGAGAATGAGGTTGAAGATGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-1557s1c1
Sequence:CCGGCTCAGCGTGGACCATTTCAATCTCGAGATTGAAATGGTCCACGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-2309s1c1
Sequence:CCGGTCTCCAGCTTTCTGCCAACATCTCGAGATGTTGGCAGAAAGCTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020897
HCN3 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-552s1c1
Sequence:CCGGCCTGTGGATTACATCTTCCTACTCGAGTAGGAAGATGTAATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-395s1c1
Sequence:CCGGCAACGTATTGTCTGATACTTTCTCGAGAAAGTATCAGACAATACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-753s1c1
Sequence:CCGGGTTCGCATCTTCAACCTCATTCTCGAGAATGAGGTTGAAGATGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-1557s1c1
Sequence:CCGGCTCAGCGTGGACCATTTCAATCTCGAGATTGAAATGGTCCACGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-2309s1c1
Sequence:CCGGTCTCCAGCTTTCTGCCAACATCTCGAGATGTTGGCAGAAAGCTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020897
HCN3 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-552s1c1
Sequence:CCGGCCTGTGGATTACATCTTCCTACTCGAGTAGGAAGATGTAATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-395s1c1
Sequence:CCGGCAACGTATTGTCTGATACTTTCTCGAGAAAGTATCAGACAATACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-753s1c1
Sequence:CCGGGTTCGCATCTTCAACCTCATTCTCGAGAATGAGGTTGAAGATGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-1557s1c1
Sequence:CCGGCTCAGCGTGGACCATTTCAATCTCGAGATTGAAATGGTCCACGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020897.1-2309s1c1
Sequence:CCGGTCTCCAGCTTTCTGCCAACATCTCGAGATGTTGGCAGAAAGCTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)