EMAIL THIS PAGE TO A FRIEND

HCN4

hyperpolarization activated cyclic nucleotide-gated potassium channel 4

121 Gene Product Result for
Synonyms: SSS2
UniProtKB ID: Q9Y3Q4, Q9UMQ7
Gene ID:
Human(10021) Summary: This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
Mouse(330953) hyperpolarization-activated, cyclic nucleotide-gated K+ 4
Rat(59266) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
domestic guinea pig(100717049) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
naked mole-rat(101715130) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
sheep(101117337) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Domestic Rabbit(100009452) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Zebrafish(557843) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
cow(785689) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
domestic cat(101090363) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
dog(448794) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
chicken(427478) hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005477 Rosetta Predictions human pricing
NM_021658 Rosetta Predictions rat pricing
NM_001081192 Rosetta Predictions mouse pricing
XM_287905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196681 predicted 1645
2 SASI_Hs01_00196682 predicted 2442
3 SASI_Hs01_00196683 predicted 1445
4 SASI_Hs01_00196684 predicted 1504
5 SASI_Hs01_00196686 predicted 3280
6 SASI_Hs01_00196687 predicted 3109
7 SASI_Hs01_00196688 predicted 2921
8 SASI_Hs01_00196690 predicted 3282
9 SASI_Hs02_00339655 predicted 2760
10 SASI_Hs02_00339656 predicted 1620
11 SASI_Hs01_00196685 predicted 1382
12 SASI_Hs01_00196689 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098138 predicted 2110
2 SASI_Rn01_00098139 predicted 1350
3 SASI_Rn02_00262655 predicted 1573
4 SASI_Rn01_00098141 predicted 1304
5 SASI_Rn01_00098142 predicted 902
6 SASI_Rn01_00098143 predicted 959
7 SASI_Rn02_00262656 predicted 3623
8 SASI_Rn02_00262657 predicted 964
9 SASI_Rn01_00098144 predicted 1144
10 SASI_Rn01_00098146 predicted 2402
11 SASI_Rn01_00098140 predicted 1218
12 SASI_Rn01_00098145 predicted 2591
13 SASI_Rn01_00098147 predicted 2553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296091 predicted 1876
2 SASI_Mm02_00296092 predicted 1081
3 SASI_Mm02_00296093 predicted 727
4 SASI_Mm02_00296094 predicted 1792
5 SASI_Mm02_00296095 predicted 990
6 SASI_Mm02_00296096 predicted 1777
7 SASI_Mm02_00296097 predicted 3409
8 SASI_Mm02_00296098 predicted 2357
9 SASI_Mm02_00296099 predicted 1818
10 SASI_Mm02_00296100 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_287905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254996 predicted 3243
2 SASI_Mm01_00254997 predicted 3453
3 SASI_Mm01_00254998 predicted 2545
4 SASI_Mm01_00254999 predicted 2486
5 SASI_Mm01_00255000 predicted 3436
6 SASI_Mm01_00255001 predicted 2487
7 SASI_Mm01_00255002 predicted 2480
8 SASI_Mm01_00255003 predicted 2361
9 SASI_Mm01_00255004 predicted 2969
10 SASI_Mm01_00255005 predicted 2714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081192
HCN4 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1646s21c1
Sequence:CCGGAGCGCATCCATGACTACTATGCTCGAGCATAGTAGTCATGGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1175s21c1
Sequence:CCGGCCCGCCTCATTCGATACATTCCTCGAGGAATGTATCGAATGAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-2014s21c1
Sequence:CCGGAGCGTCAGAGCGGATACTTATCTCGAGATAAGTATCCGCTCTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-3582s21c1
Sequence:CCGGCTCCAAACTGCCGTCTAATTTCTCGAGAAATTAGACGGCAGTTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1733s21c1
Sequence:CCGGGAGAGGAGATCATCAACTTTACTCGAGTAAAGTTGATGATCTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081192
HCN4 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1646s21c1
Sequence:CCGGAGCGCATCCATGACTACTATGCTCGAGCATAGTAGTCATGGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1175s21c1
Sequence:CCGGCCCGCCTCATTCGATACATTCCTCGAGGAATGTATCGAATGAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-2014s21c1
Sequence:CCGGAGCGTCAGAGCGGATACTTATCTCGAGATAAGTATCCGCTCTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-3582s21c1
Sequence:CCGGCTCCAAACTGCCGTCTAATTTCTCGAGAAATTAGACGGCAGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1733s21c1
Sequence:CCGGGAGAGGAGATCATCAACTTTACTCGAGTAAAGTTGATGATCTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081192
HCN4 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1646s21c1
Sequence:CCGGAGCGCATCCATGACTACTATGCTCGAGCATAGTAGTCATGGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1175s21c1
Sequence:CCGGCCCGCCTCATTCGATACATTCCTCGAGGAATGTATCGAATGAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-2014s21c1
Sequence:CCGGAGCGTCAGAGCGGATACTTATCTCGAGATAAGTATCCGCTCTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-3582s21c1
Sequence:CCGGCTCCAAACTGCCGTCTAATTTCTCGAGAAATTAGACGGCAGTTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081192.1-1733s21c1
Sequence:CCGGGAGAGGAGATCATCAACTTTACTCGAGTAAAGTTGATGATCTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005477
HCN4 MISSION shRNA Bacterial Glycerol Stock
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-633s1c1
Sequence:CCGGGCGTGGATCATGGACGAGGAACTCGAGTTCCTCGTCCATGATCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1386s1c1
Sequence:CCGGGTGGGAAACCTGATTATCATTCTCGAGAATGATAATCAGGTTTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1443s1c1
Sequence:CCGGACACCCTGGATTGTCTTCAATCTCGAGATTGAAGACAATCCAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-4028s1c1
Sequence:CCGGGAAGACATCCTCAGGTTCTTTCTCGAGAAAGAACCTGAGGATGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-2771s1c1
Sequence:CCGGCTACCAGGAGAATGAGATCATCTCGAGATGATCTCATTCTCCTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4981s21c1
Sequence:CCGCCATCAGCCCGTTAGCTGTAACCTCGAGGTTACAGCTAACGGGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4666s21c1
Sequence:CCGGTTAACTGTGATTAGGAGATATCTCGAGATATCTCCTAATCACAGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005477
HCN4 MISSION shRNA shRNA Plasmid DNA
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-633s1c1
Sequence:CCGGGCGTGGATCATGGACGAGGAACTCGAGTTCCTCGTCCATGATCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1386s1c1
Sequence:CCGGGTGGGAAACCTGATTATCATTCTCGAGAATGATAATCAGGTTTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1443s1c1
Sequence:CCGGACACCCTGGATTGTCTTCAATCTCGAGATTGAAGACAATCCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-4028s1c1
Sequence:CCGGGAAGACATCCTCAGGTTCTTTCTCGAGAAAGAACCTGAGGATGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-2771s1c1
Sequence:CCGGCTACCAGGAGAATGAGATCATCTCGAGATGATCTCATTCTCCTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4981s21c1
Sequence:CCGCCATCAGCCCGTTAGCTGTAACCTCGAGGTTACAGCTAACGGGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4666s21c1
Sequence:CCGGTTAACTGTGATTAGGAGATATCTCGAGATATCTCCTAATCACAGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005477
HCN4 MISSION shRNA Lentiviral Transduction Particles
hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-633s1c1
Sequence:CCGGGCGTGGATCATGGACGAGGAACTCGAGTTCCTCGTCCATGATCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1386s1c1
Sequence:CCGGGTGGGAAACCTGATTATCATTCTCGAGAATGATAATCAGGTTTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-1443s1c1
Sequence:CCGGACACCCTGGATTGTCTTCAATCTCGAGATTGAAGACAATCCAGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-4028s1c1
Sequence:CCGGGAAGACATCCTCAGGTTCTTTCTCGAGAAAGAACCTGAGGATGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005477.1-2771s1c1
Sequence:CCGGCTACCAGGAGAATGAGATCATCTCGAGATGATCTCATTCTCCTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4981s21c1
Sequence:CCGCCATCAGCCCGTTAGCTGTAACCTCGAGGTTACAGCTAACGGGCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005477.2-4666s21c1
Sequence:CCGGTTAACTGTGATTAGGAGATATCTCGAGATATCTCCTAATCACAGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)