EMAIL THIS PAGE TO A FRIEND

HCP5

HLA complex P5 (non-protein coding)

7 Gene Product Result for
Synonyms: 6S2650E D6S2650E P5-1
Species: Human HCP5(10866)
UniProtKB ID: Q6MZN7, Q04490
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006674 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104141 MISSION® esiRNA esiRNA human AL671277.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006674
HCP5 MISSION shRNA Bacterial Glycerol Stock
HLA complex P5 (non-protein coding)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-644s1c1
Sequence:CCGGGATCTATTACCTGTGCCTGGACTCGAGTCCAGGCACAGGTAATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-421s1c1
Sequence:CCGGGAACGAGGCCTTGGGAAATTACTCGAGTAATTTCCCAAGGCCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-429s1c1
Sequence:CCGGCCTTGGGAAATTACCTGGAAACTCGAGTTTCCAGGTAATTTCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-490s1c1
Sequence:CCGGGAAATCAAACCCTCTCAGGTTCTCGAGAACCTGAGAGGGTTTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-522s1c1
Sequence:CCGGCGATTCTCCTCACACTTACAACTCGAGTTGTAAGTGTGAGGAGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-523s1c1
Sequence:CCGGGATTCTCCTCACACTTACAATCTCGAGATTGTAAGTGTGAGGAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-638s1c1
Sequence:CCGGGATCAGGATCTATTACCTGTGCTCGAGCACAGGTAATAGATCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-486s1c1
Sequence:CCGGCTTGGAAATCAAACCCTCTCACTCGAGTGAGAGGGTTTGATTTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-428s1c1
Sequence:CCGGGCCTTGGGAAATTACCTGGAACTCGAGTTCCAGGTAATTTCCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006674
HCP5 MISSION shRNA shRNA Plasmid DNA
HLA complex P5 (non-protein coding)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-644s1c1
Sequence:CCGGGATCTATTACCTGTGCCTGGACTCGAGTCCAGGCACAGGTAATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-421s1c1
Sequence:CCGGGAACGAGGCCTTGGGAAATTACTCGAGTAATTTCCCAAGGCCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-429s1c1
Sequence:CCGGCCTTGGGAAATTACCTGGAAACTCGAGTTTCCAGGTAATTTCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-490s1c1
Sequence:CCGGGAAATCAAACCCTCTCAGGTTCTCGAGAACCTGAGAGGGTTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-522s1c1
Sequence:CCGGCGATTCTCCTCACACTTACAACTCGAGTTGTAAGTGTGAGGAGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-523s1c1
Sequence:CCGGGATTCTCCTCACACTTACAATCTCGAGATTGTAAGTGTGAGGAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-638s1c1
Sequence:CCGGGATCAGGATCTATTACCTGTGCTCGAGCACAGGTAATAGATCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-486s1c1
Sequence:CCGGCTTGGAAATCAAACCCTCTCACTCGAGTGAGAGGGTTTGATTTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-428s1c1
Sequence:CCGGGCCTTGGGAAATTACCTGGAACTCGAGTTCCAGGTAATTTCCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006674
HCP5 MISSION shRNA Lentiviral Transduction Particles
HLA complex P5 (non-protein coding)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-644s1c1
Sequence:CCGGGATCTATTACCTGTGCCTGGACTCGAGTCCAGGCACAGGTAATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-421s1c1
Sequence:CCGGGAACGAGGCCTTGGGAAATTACTCGAGTAATTTCCCAAGGCCTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-429s1c1
Sequence:CCGGCCTTGGGAAATTACCTGGAAACTCGAGTTTCCAGGTAATTTCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-490s1c1
Sequence:CCGGGAAATCAAACCCTCTCAGGTTCTCGAGAACCTGAGAGGGTTTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-522s1c1
Sequence:CCGGCGATTCTCCTCACACTTACAACTCGAGTTGTAAGTGTGAGGAGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-523s1c1
Sequence:CCGGGATTCTCCTCACACTTACAATCTCGAGATTGTAAGTGTGAGGAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-638s1c1
Sequence:CCGGGATCAGGATCTATTACCTGTGCTCGAGCACAGGTAATAGATCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006674.1-486s1c1
Sequence:CCGGCTTGGAAATCAAACCCTCTCACTCGAGTGAGAGGGTTTGATTTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006674.1-428s1c1
Sequence:CCGGGCCTTGGGAAATTACCTGGAACTCGAGTTCCAGGTAATTTCCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)