EMAIL THIS PAGE TO A FRIEND

HCRT

hypocretin (orexin) neuropeptide precursor

55 Gene Product Result for
Synonyms: NRCLP1 OX PPOX
UniProtKB ID: O43612
Gene ID:
Human(3060) Summary: This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Jan 2010]
Mouse(15171) hypocretin
Rat(25723) hypocretin
Zebrafish(613239) hypocretin (orexin) neuropeptide precursor
dog(607641) hypocretin (orexin) neuropeptide precursor
chicken(374005) hypocretin (orexin) neuropeptide precursor
cow(281222) hypocretin (orexin) neuropeptide precursor
sheep(101122291) hypocretin (orexin) neuropeptide precursor
domestic guinea pig(100717357) hypocretin (orexin) neuropeptide precursor
naked mole-rat(101723299) hypocretin (orexin) neuropeptide precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001524 Rosetta Predictions human pricing
NM_013179 Rosetta Predictions rat pricing
NM_010410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179330 predicted 357
2 SASI_Hs01_00179331 predicted 194
3 SASI_Hs01_00179332 predicted 466
4 SASI_Hs01_00179333 predicted 187
5 SASI_Hs01_00179334 predicted 458
6 SASI_Hs01_00179335 predicted 253
7 SASI_Hs01_00179336 predicted 214
8 SASI_Hs01_00179337 predicted 345
9 SASI_Hs01_00179338 predicted 442
10 SASI_Hs01_00179339 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061504 predicted 485
2 SASI_Rn01_00061505 predicted 93
3 SASI_Rn01_00061506 predicted 216
4 SASI_Rn01_00061507 predicted 479
5 SASI_Rn01_00061508 predicted 484
6 SASI_Rn01_00061509 predicted 470
7 SASI_Rn01_00061510 predicted 512
8 SASI_Rn01_00061511 predicted 523
9 SASI_Rn01_00061512 predicted 430
10 SASI_Rn02_00261008 predicted 394
11 SASI_Rn01_00061503 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199825 predicted 267
2 SASI_Mm02_00318545 predicted 333
3 SASI_Mm01_00199826 predicted 475
4 SASI_Mm01_00199827 predicted 490
5 SASI_Mm01_00199828 predicted 531
6 SASI_Mm01_00199829 predicted 471
7 SASI_Mm01_00199830 predicted 524
8 SASI_Mm01_00199831 predicted 427
9 SASI_Mm01_00199832 predicted 432
10 SASI_Mm01_00199834 predicted 549
11 SASI_Mm01_00199833 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010410
HCRT MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) neuropeptide precursor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000104987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-217s1c1
Sequence:CCGGGACGTGTTCCTGCCGTCTCTACTCGAGTAGAGACGGCAGGAACACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-435s1c1
Sequence:CCGGCGACCGTAACTACCACCGCTTCTCGAGAAGCGGTGGTAGTTACGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-334s1c1
Sequence:CCGGCCTCCTTCAGGCCAACGGTAACTCGAGTTACCGTTGGCCTGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-226s1c1
Sequence:CCGGCTGCCGTCTCTACGAACTGTTCTCGAGAACAGTTCGTAGAGACGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010410
HCRT MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) neuropeptide precursor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000104987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-217s1c1
Sequence:CCGGGACGTGTTCCTGCCGTCTCTACTCGAGTAGAGACGGCAGGAACACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-435s1c1
Sequence:CCGGCGACCGTAACTACCACCGCTTCTCGAGAAGCGGTGGTAGTTACGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-334s1c1
Sequence:CCGGCCTCCTTCAGGCCAACGGTAACTCGAGTTACCGTTGGCCTGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-226s1c1
Sequence:CCGGCTGCCGTCTCTACGAACTGTTCTCGAGAACAGTTCGTAGAGACGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010410
HCRT MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) neuropeptide precursor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000104987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-217s1c1
Sequence:CCGGGACGTGTTCCTGCCGTCTCTACTCGAGTAGAGACGGCAGGAACACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-435s1c1
Sequence:CCGGCGACCGTAACTACCACCGCTTCTCGAGAAGCGGTGGTAGTTACGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-334s1c1
Sequence:CCGGCCTCCTTCAGGCCAACGGTAACTCGAGTTACCGTTGGCCTGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010410.1-226s1c1
Sequence:CCGGCTGCCGTCTCTACGAACTGTTCTCGAGAACAGTTCGTAGAGACGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001524
HCRT MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) neuropeptide precursor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-270s1c1
Sequence:CCGGCGGCATCCTCACGCTGGGCAACTCGAGTTGCCCAGCGTGAGGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-216s1c1
Sequence:CCGGGACTTGCTCTTGCCGCCTCTACTCGAGTAGAGGCGGCAAGAGCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-228s1c1
Sequence:CCGGCCGCCTCTACGAGCTGCTGCACTCGAGTGCAGCAGCTCGTAGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-123s1c1
Sequence:CCGGCGTGACGCTACTGCTGCTGCTCTCGAGAGCAGCAGCAGTAGCGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-193s1c1
Sequence:CCGGCTGCCCGACTGCTGTCGTCAACTCGAGTTGACGACAGCAGTCGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001524
HCRT MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) neuropeptide precursor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-270s1c1
Sequence:CCGGCGGCATCCTCACGCTGGGCAACTCGAGTTGCCCAGCGTGAGGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-216s1c1
Sequence:CCGGGACTTGCTCTTGCCGCCTCTACTCGAGTAGAGGCGGCAAGAGCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-228s1c1
Sequence:CCGGCCGCCTCTACGAGCTGCTGCACTCGAGTGCAGCAGCTCGTAGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-123s1c1
Sequence:CCGGCGTGACGCTACTGCTGCTGCTCTCGAGAGCAGCAGCAGTAGCGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-193s1c1
Sequence:CCGGCTGCCCGACTGCTGTCGTCAACTCGAGTTGACGACAGCAGTCGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001524
HCRT MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) neuropeptide precursor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-270s1c1
Sequence:CCGGCGGCATCCTCACGCTGGGCAACTCGAGTTGCCCAGCGTGAGGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-216s1c1
Sequence:CCGGGACTTGCTCTTGCCGCCTCTACTCGAGTAGAGGCGGCAAGAGCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-228s1c1
Sequence:CCGGCCGCCTCTACGAGCTGCTGCACTCGAGTGCAGCAGCTCGTAGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-123s1c1
Sequence:CCGGCGTGACGCTACTGCTGCTGCTCTCGAGAGCAGCAGCAGTAGCGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001524.1-193s1c1
Sequence:CCGGCTGCCCGACTGCTGTCGTCAACTCGAGTTGACGACAGCAGTCGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)