EMAIL THIS PAGE TO A FRIEND

HCRTR1

hypocretin (orexin) receptor 1

77 Gene Product Result for
Synonyms: OX1R
UniProtKB ID: O43613, A8K3A6, Q9HBV6
Gene ID:
Human(3061) Summary: The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
Mouse(230777) hypocretin (orexin) receptor 1
Rat(25593) hypocretin (orexin) receptor 1
domestic guinea pig(100730642) hypocretin (orexin) receptor 1
naked mole-rat(101704562) hypocretin (orexin) receptor 1
Horse(100056164) hypocretin (orexin) receptor 1
cow(282248) hypocretin (orexin) receptor 1
domestic cat(101095509) hypocretin (orexin) receptor 1
dog(487320) hypocretin (orexin) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001525 Rosetta Predictions human pricing
NM_013064 Rosetta Predictions rat pricing
NM_198959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036376 predicted 302
2 SASI_Hs01_00036377 predicted 538
3 SASI_Hs01_00036378 predicted 597
4 SASI_Hs01_00036379 predicted 583
5 SASI_Hs01_00036380 predicted 1090
6 SASI_Hs01_00036381 predicted 1135
7 SASI_Hs01_00036382 predicted 251
8 SASI_Hs01_00036383 predicted 420
9 SASI_Hs01_00036384 predicted 253
10 SASI_Hs01_00036385 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107715 predicted 1637
2 SASI_Rn01_00107717 predicted 2073
3 SASI_Rn01_00107718 predicted 2099
4 SASI_Rn01_00107719 predicted 1716
5 SASI_Rn01_00107720 predicted 1949
6 SASI_Rn01_00107721 predicted 733
7 SASI_Rn01_00107722 predicted 2095
8 SASI_Rn01_00107723 predicted 1791
9 SASI_Rn01_00107724 predicted 1876
10 SASI_Rn02_00260804 predicted 1772
11 SASI_Rn01_00107716 predicted 1768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071198 predicted 481
2 SASI_Mm01_00071199 predicted 1825
3 SASI_Mm01_00071200 predicted 1195
4 SASI_Mm01_00071201 predicted 1822
5 SASI_Mm01_00071202 predicted 1865
6 SASI_Mm01_00071203 predicted 439
7 SASI_Mm01_00071204 predicted 1862
8 SASI_Mm02_00351245 predicted 642
9 SASI_Mm01_00071205 predicted 1089
10 SASI_Mm01_00071207 predicted 1468
11 SASI_Mm01_00071206 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001525
HCRTR1 MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-261s1c1
Sequence:CCGGGCGTGATTATCTGTACCCAAACTCGAGTTTGGGTACAGATAATCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-745s1c1
Sequence:CCGGCTCTTCTCAGTCTGTGATGAACTCGAGTTCATCACAGACTGAGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-1104s1c1
Sequence:CCGGCAATGTCCTTAAGAGGGTGTTCTCGAGAACACCCTCTTAAGGACATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-250s1c1
Sequence:CCGGCGCTATCTGTGGCGTGATTATCTCGAGATAATCACGCCACAGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-823s21c1
Sequence:CCGGTGCCATCTGCCACCCACTATTCTCGAGAATAGTGGGTGGCAGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1459s21c1
Sequence:CCGGCAACTTCCTCAGTGGCAAATTCTCGAGAATTTGCCACTGAGGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-482s21c1
Sequence:CCGGCGCTATCTGTGGCGCGATTATCTCGAGATAATCGCGCCACAGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1073s21c1
Sequence:CCGGCTCATGGCCATGGCCTATTTCCTCGAGGAAATAGGCCATGGCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001525
HCRTR1 MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-261s1c1
Sequence:CCGGGCGTGATTATCTGTACCCAAACTCGAGTTTGGGTACAGATAATCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-745s1c1
Sequence:CCGGCTCTTCTCAGTCTGTGATGAACTCGAGTTCATCACAGACTGAGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-1104s1c1
Sequence:CCGGCAATGTCCTTAAGAGGGTGTTCTCGAGAACACCCTCTTAAGGACATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-250s1c1
Sequence:CCGGCGCTATCTGTGGCGTGATTATCTCGAGATAATCACGCCACAGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-823s21c1
Sequence:CCGGTGCCATCTGCCACCCACTATTCTCGAGAATAGTGGGTGGCAGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1459s21c1
Sequence:CCGGCAACTTCCTCAGTGGCAAATTCTCGAGAATTTGCCACTGAGGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-482s21c1
Sequence:CCGGCGCTATCTGTGGCGCGATTATCTCGAGATAATCGCGCCACAGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1073s21c1
Sequence:CCGGCTCATGGCCATGGCCTATTTCCTCGAGGAAATAGGCCATGGCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001525
HCRTR1 MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-261s1c1
Sequence:CCGGGCGTGATTATCTGTACCCAAACTCGAGTTTGGGTACAGATAATCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-745s1c1
Sequence:CCGGCTCTTCTCAGTCTGTGATGAACTCGAGTTCATCACAGACTGAGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-1104s1c1
Sequence:CCGGCAATGTCCTTAAGAGGGTGTTCTCGAGAACACCCTCTTAAGGACATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001525.1-250s1c1
Sequence:CCGGCGCTATCTGTGGCGTGATTATCTCGAGATAATCACGCCACAGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-823s21c1
Sequence:CCGGTGCCATCTGCCACCCACTATTCTCGAGAATAGTGGGTGGCAGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1459s21c1
Sequence:CCGGCAACTTCCTCAGTGGCAAATTCTCGAGAATTTGCCACTGAGGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-482s21c1
Sequence:CCGGCGCTATCTGTGGCGCGATTATCTCGAGATAATCGCGCCACAGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001525.2-1073s21c1
Sequence:CCGGCTCATGGCCATGGCCTATTTCCTCGAGGAAATAGGCCATGGCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198959
HCRTR1 MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) receptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-763s1c1
Sequence:CCGGCCACTGTTGTTCAAGAGCACACTCGAGTGTGCTCTTGAACAACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-420s1c1
Sequence:CCGGGCGCGATTATCTCTACCCGAACTCGAGTTCGGGTAGAGATAATCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1374s1c1
Sequence:CCGGCCCTATCATCTACAACTTCCTCTCGAGAGGAAGTTGTAGATGATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198959.1-1738s1c1
Sequence:CCGGGCTGCTCAAGAAAGCAGTGTTCTCGAGAACACTGCTTTCTTGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1263s1c1
Sequence:CCGGCAATGTCCTTAAGAGAGTGTTCTCGAGAACACTCTCTTAAGGACATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-659s21c1
Sequence:CCGGAGGCTTTGTGCAAGGTCATTCCTCGAGGAATGACCTTGCACAAAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-443s21c1
Sequence:CCGGAGTACGAGTGGGTTCTCATTGCTCGAGCAATGAGAACCCACTCGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198959
HCRTR1 MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) receptor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-763s1c1
Sequence:CCGGCCACTGTTGTTCAAGAGCACACTCGAGTGTGCTCTTGAACAACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-420s1c1
Sequence:CCGGGCGCGATTATCTCTACCCGAACTCGAGTTCGGGTAGAGATAATCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1374s1c1
Sequence:CCGGCCCTATCATCTACAACTTCCTCTCGAGAGGAAGTTGTAGATGATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198959.1-1738s1c1
Sequence:CCGGGCTGCTCAAGAAAGCAGTGTTCTCGAGAACACTGCTTTCTTGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1263s1c1
Sequence:CCGGCAATGTCCTTAAGAGAGTGTTCTCGAGAACACTCTCTTAAGGACATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-659s21c1
Sequence:CCGGAGGCTTTGTGCAAGGTCATTCCTCGAGGAATGACCTTGCACAAAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-443s21c1
Sequence:CCGGAGTACGAGTGGGTTCTCATTGCTCGAGCAATGAGAACCCACTCGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198959
HCRTR1 MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) receptor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-763s1c1
Sequence:CCGGCCACTGTTGTTCAAGAGCACACTCGAGTGTGCTCTTGAACAACAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-420s1c1
Sequence:CCGGGCGCGATTATCTCTACCCGAACTCGAGTTCGGGTAGAGATAATCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1374s1c1
Sequence:CCGGCCCTATCATCTACAACTTCCTCTCGAGAGGAAGTTGTAGATGATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198959.1-1738s1c1
Sequence:CCGGGCTGCTCAAGAAAGCAGTGTTCTCGAGAACACTGCTTTCTTGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198959.1-1263s1c1
Sequence:CCGGCAATGTCCTTAAGAGAGTGTTCTCGAGAACACTCTCTTAAGGACATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-659s21c1
Sequence:CCGGAGGCTTTGTGCAAGGTCATTCCTCGAGGAATGACCTTGCACAAAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198959.2-443s21c1
Sequence:CCGGAGTACGAGTGGGTTCTCATTGCTCGAGCAATGAGAACCCACTCGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)