EMAIL THIS PAGE TO A FRIEND

HCRTR2

hypocretin (orexin) receptor 2

55 Gene Product Result for
Synonyms: OX2R
UniProtKB ID: O43614, Q5VTM0
Gene ID:
Human(3062) Summary: The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
Mouse(387285) hypocretin (orexin) receptor 2
Rat(25605) hypocretin (orexin) receptor 2
Zebrafish(561260) hypocretin (orexin) receptor 2
cow(529603) hypocretin (orexin) receptor 2
Horse(100056772) hypocretin (orexin) receptor 2
domestic cat(101088488) hypocretin (orexin) receptor 2
dog(399545) hypocretin (orexin) receptor 2
chicken(428644) hypocretin (orexin) receptor 2
domestic guinea pig(100733363) hypocretin (orexin) receptor 2
naked mole-rat(101723112) hypocretin (orexin) receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051481 MISSION® esiRNA esiRNA human HCRTR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001526 Rosetta Predictions human pricing
NM_013074 Rosetta Predictions rat pricing
NM_198962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104253 predicted 697
2 SASI_Hs01_00104254 predicted 1346
3 SASI_Hs01_00104255 predicted 1308
4 SASI_Hs01_00104257 predicted 564
5 SASI_Hs02_00332056 predicted 1289
6 SASI_Hs02_00332057 predicted 834
7 SASI_Hs01_00104258 predicted 844
8 SASI_Hs01_00104259 predicted 1260
9 SASI_Hs01_00104260 predicted 829
10 SASI_Hs01_00104261 predicted 1543
11 SASI_Hs01_00104256 predicted 1049
12 SASI_Hs01_00104262 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260828 predicted 981
2 SASI_Rn01_00073816 predicted 666
3 SASI_Rn01_00073817 predicted 565
4 SASI_Rn01_00073818 predicted 1523
5 SASI_Rn01_00073819 predicted 1280
6 SASI_Rn01_00073820 predicted 572
7 SASI_Rn01_00073821 predicted 592
8 SASI_Rn01_00073822 predicted 818
9 SASI_Rn01_00073823 predicted 1244
10 SASI_Rn01_00073824 predicted 560
11 SASI_Rn01_00073825 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105021 predicted 574
2 SASI_Mm02_00351250 predicted 776
3 SASI_Mm01_00105022 predicted 668
4 SASI_Mm01_00105023 predicted 587
5 SASI_Mm01_00105024 predicted 1303
6 SASI_Mm01_00105025 predicted 611
7 SASI_Mm01_00105027 predicted 207
8 SASI_Mm01_00105028 predicted 828
9 SASI_Mm01_00105029 predicted 927
10 SASI_Mm01_00105030 predicted 1118
11 SASI_Mm01_00105026 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001526
HCRTR2 MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1547s21c1
Sequence:CCGGTCAGCAACTTTGATAACATATCTCGAGATATGTTATCAAAGTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1256s21c1
Sequence:CCGGCAATTTGCTATCTACCAATTACTCGAGTAATTGGTAGATAGCAAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-804s1c1
Sequence:CCGGGATGTTTAAGAGCACAGCAAACTCGAGTTTGCTGTGCTCTTAAACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-983s1c1
Sequence:CCGGCCAAGATGTACCACATCTGTTCTCGAGAACAGATGTGGTACATCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1385s21c1
Sequence:CCGGGTGCTGCGAATCCAATTATTTCTCGAGAAATAATTGGATTCGCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001526.2-1674s1c1
Sequence:CCGGTGACAAGGATACCTGAGTAAACTCGAGTTTACTCAGGTATCCTTGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-1536s1c1
Sequence:CCGGGAAGTCCTTGACCACTCAAATCTCGAGATTTGAGTGGTCAAGGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001526
HCRTR2 MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1547s21c1
Sequence:CCGGTCAGCAACTTTGATAACATATCTCGAGATATGTTATCAAAGTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1256s21c1
Sequence:CCGGCAATTTGCTATCTACCAATTACTCGAGTAATTGGTAGATAGCAAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-804s1c1
Sequence:CCGGGATGTTTAAGAGCACAGCAAACTCGAGTTTGCTGTGCTCTTAAACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-983s1c1
Sequence:CCGGCCAAGATGTACCACATCTGTTCTCGAGAACAGATGTGGTACATCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1385s21c1
Sequence:CCGGGTGCTGCGAATCCAATTATTTCTCGAGAAATAATTGGATTCGCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001526.2-1674s1c1
Sequence:CCGGTGACAAGGATACCTGAGTAAACTCGAGTTTACTCAGGTATCCTTGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-1536s1c1
Sequence:CCGGGAAGTCCTTGACCACTCAAATCTCGAGATTTGAGTGGTCAAGGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001526
HCRTR2 MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1547s21c1
Sequence:CCGGTCAGCAACTTTGATAACATATCTCGAGATATGTTATCAAAGTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1256s21c1
Sequence:CCGGCAATTTGCTATCTACCAATTACTCGAGTAATTGGTAGATAGCAAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-804s1c1
Sequence:CCGGGATGTTTAAGAGCACAGCAAACTCGAGTTTGCTGTGCTCTTAAACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-983s1c1
Sequence:CCGGCCAAGATGTACCACATCTGTTCTCGAGAACAGATGTGGTACATCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001526.3-1385s21c1
Sequence:CCGGGTGCTGCGAATCCAATTATTTCTCGAGAAATAATTGGATTCGCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001526.2-1674s1c1
Sequence:CCGGTGACAAGGATACCTGAGTAAACTCGAGTTTACTCAGGTATCCTTGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001526.2-1536s1c1
Sequence:CCGGGAAGTCCTTGACCACTCAAATCTCGAGATTTGAGTGGTCAAGGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198962
HCRTR2 MISSION shRNA Bacterial Glycerol Stock
hypocretin (orexin) receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-720s1c1
Sequence:CCGGCGGTGAAGTTTACCCAAAGATCTCGAGATCTTTGGGTAAACTTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-1307s1c1
Sequence:CCGGGCAACTTTGACAATGTATCAACTCGAGTTGATACATTGTCAAAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-450s1c1
Sequence:CCGGCCTCTGTAAGGTCATTCCTTACTCGAGTAAGGAATGACCTTACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-676s1c1
Sequence:CCGGGCCAATAAGACCACCCTCTTTCTCGAGAAAGAGGGTGGTCTTATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-249s1c1
Sequence:CCGGCGCAGGGTATATCATCGTGTTCTCGAGAACACGATGATATACCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198962
HCRTR2 MISSION shRNA shRNA Plasmid DNA
hypocretin (orexin) receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-720s1c1
Sequence:CCGGCGGTGAAGTTTACCCAAAGATCTCGAGATCTTTGGGTAAACTTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-1307s1c1
Sequence:CCGGGCAACTTTGACAATGTATCAACTCGAGTTGATACATTGTCAAAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-450s1c1
Sequence:CCGGCCTCTGTAAGGTCATTCCTTACTCGAGTAAGGAATGACCTTACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-676s1c1
Sequence:CCGGGCCAATAAGACCACCCTCTTTCTCGAGAAAGAGGGTGGTCTTATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-249s1c1
Sequence:CCGGCGCAGGGTATATCATCGTGTTCTCGAGAACACGATGATATACCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198962
HCRTR2 MISSION shRNA Lentiviral Transduction Particles
hypocretin (orexin) receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-720s1c1
Sequence:CCGGCGGTGAAGTTTACCCAAAGATCTCGAGATCTTTGGGTAAACTTCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-1307s1c1
Sequence:CCGGGCAACTTTGACAATGTATCAACTCGAGTTGATACATTGTCAAAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-450s1c1
Sequence:CCGGCCTCTGTAAGGTCATTCCTTACTCGAGTAAGGAATGACCTTACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-676s1c1
Sequence:CCGGGCCAATAAGACCACCCTCTTTCTCGAGAAAGAGGGTGGTCTTATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198962.1-249s1c1
Sequence:CCGGCGCAGGGTATATCATCGTGTTCTCGAGAACACGATGATATACCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)