EMAIL THIS PAGE TO A FRIEND

HCST

hematopoietic cell signal transducer

59 Gene Product Result for
Synonyms: DAP10 KAP10 PIK3AP
UniProtKB ID: Q9UBK5, Q9UBS1, Q9Y3Y0
Gene ID:
Human(10870) Summary: This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(23900) hematopoietic cell signal transducer
Rat(474146) hematopoietic cell signal transducer
sheep(101107544) hematopoietic cell signal transducer
Zebrafish(100101460) hematopoietic cell signal transducer
dog(612627) hematopoietic cell signal transducer
cow(767892) hematopoietic cell signal transducer
domestic cat(101097286) hematopoietic cell signal transducer
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500292 Anti-DAP10/HCST antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122191 MISSION® esiRNA esiRNA human HCST (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007469 Rosetta Predictions human pricing
NM_014266 Rosetta Predictions human pricing
NM_001005900 Rosetta Predictions rat pricing
NM_011827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157102 predicted 269
2 SASI_Hs01_00157103 predicted 206
3 SASI_Hs01_00157104 predicted 127
4 SASI_Hs01_00157105 predicted 117
5 SASI_Hs01_00157106 predicted 395
6 SASI_Hs01_00157108 predicted 164
7 SASI_Hs02_00305310 predicted 150
8 SASI_Hs02_00305311 predicted 166
9 SASI_Hs02_00305312 predicted 394
10 SASI_Hs02_00305313 predicted 279
11 SASI_Hs01_00157101 predicted 238
12 SASI_Hs01_00157107 predicted 345
13 SASI_Hs01_00157109 predicted 439
14 SASI_Hs01_00157110 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189169 predicted 276
2 SASI_Hs01_00189170 predicted 287
3 SASI_Hs01_00189171 predicted 206
4 SASI_Hs01_00189172 predicted 121
5 SASI_Hs01_00189173 predicted 113
6 SASI_Hs01_00189174 predicted 399
7 SASI_Hs01_00189175 predicted 168
8 SASI_Hs02_00345330 predicted 149
9 SASI_Hs02_00345331 predicted 173
10 SASI_Hs02_00345332 predicted 397
11 SASI_Hs01_00189168 predicted 242
12 SASI_Hs01_00189176 predicted 440
13 SASI_Hs01_00189177 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093999 predicted 201
2 SASI_Rn01_00094000 predicted 193
3 SASI_Rn01_00094001 predicted 196
4 SASI_Rn01_00094002 predicted 201
5 SASI_Rn01_00094003 predicted 361
6 SASI_Rn01_00094004 predicted 110
7 SASI_Rn01_00094005 predicted 227
8 SASI_Rn01_00094006 predicted 102
9 SASI_Rn01_00094007 predicted 250
10 SASI_Rn01_00094008 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127277 predicted 206
2 SASI_Mm01_00127278 predicted 217
3 SASI_Mm01_00127279 predicted 165
4 SASI_Mm01_00127280 predicted 363
5 SASI_Mm01_00127281 predicted 240
6 SASI_Mm01_00127282 predicted 115
7 SASI_Mm02_00321540 predicted 307
8 SASI_Mm01_00127283 predicted 220
9 SASI_Mm01_00127284 predicted 235
10 SASI_Mm01_00127285 predicted 226
11 SASI_Mm01_00127286 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014266
HCST MISSION shRNA Bacterial Glycerol Stock
hematopoietic cell signal transducer
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014266.3-351s1c1
Sequence:CCGGCCAAGAAGATGGCAAAGTCTACTCGAGTAGACTTTGCCATCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-348s21c1
Sequence:CCGGCGCCCAAGAAGATGGCAAAGTCTCGAGACTTTGCCATCTTCTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-176s21c1
Sequence:CCGGCTCCAGGAGAGAGATCATCACCTCGAGGTGATGATCTCTCTCCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-212s21c1
Sequence:CCGGCTGGCACTTCAGGCTCTTGTTCTCGAGAACAAGAGCCTGAAGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-187s21c1
Sequence:CCGGAGATCATCACTCCCTGCCTTTCTCGAGAAAGGCAGGGAGTGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-220s21c1
Sequence:CCGGTCAGGCTCTTGTTCCGGATGTCTCGAGACATCCGGAACAAGAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014266
HCST MISSION shRNA shRNA Plasmid DNA
hematopoietic cell signal transducer
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014266.3-351s1c1
Sequence:CCGGCCAAGAAGATGGCAAAGTCTACTCGAGTAGACTTTGCCATCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-348s21c1
Sequence:CCGGCGCCCAAGAAGATGGCAAAGTCTCGAGACTTTGCCATCTTCTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-176s21c1
Sequence:CCGGCTCCAGGAGAGAGATCATCACCTCGAGGTGATGATCTCTCTCCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-212s21c1
Sequence:CCGGCTGGCACTTCAGGCTCTTGTTCTCGAGAACAAGAGCCTGAAGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-187s21c1
Sequence:CCGGAGATCATCACTCCCTGCCTTTCTCGAGAAAGGCAGGGAGTGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-220s21c1
Sequence:CCGGTCAGGCTCTTGTTCCGGATGTCTCGAGACATCCGGAACAAGAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014266
HCST MISSION shRNA Lentiviral Transduction Particles
hematopoietic cell signal transducer
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014266.3-351s1c1
Sequence:CCGGCCAAGAAGATGGCAAAGTCTACTCGAGTAGACTTTGCCATCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-348s21c1
Sequence:CCGGCGCCCAAGAAGATGGCAAAGTCTCGAGACTTTGCCATCTTCTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-176s21c1
Sequence:CCGGCTCCAGGAGAGAGATCATCACCTCGAGGTGATGATCTCTCTCCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-212s21c1
Sequence:CCGGCTGGCACTTCAGGCTCTTGTTCTCGAGAACAAGAGCCTGAAGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-187s21c1
Sequence:CCGGAGATCATCACTCCCTGCCTTTCTCGAGAAAGGCAGGGAGTGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014266.3-220s21c1
Sequence:CCGGTCAGGCTCTTGTTCCGGATGTCTCGAGACATCCGGAACAAGAGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011827
HCST MISSION shRNA Bacterial Glycerol Stock
hematopoietic cell signal transducer
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-54s1c1
Sequence:CCGGCGGATGTGGGACTCTGTCTCTCTCGAGAGAGACAGAGTCCCACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-39s1c1
Sequence:CCGGCCCAGGTTCCTGCTCCGGATGCTCGAGCATCCGGAGCAGGAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-38s1c1
Sequence:CCGGTCCCAGGTTCCTGCTCCGGATCTCGAGATCCGGAGCAGGAACCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-48s1c1
Sequence:CCGGCTGCTCCGGATGTGGGACTCTCTCGAGAGAGTCCCACATCCGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-29s1c1
Sequence:CCGGTGCTTCTGCTCCCAGGTTCCTCTCGAGAGGAACCTGGGAGCAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011827
HCST MISSION shRNA shRNA Plasmid DNA
hematopoietic cell signal transducer
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-54s1c1
Sequence:CCGGCGGATGTGGGACTCTGTCTCTCTCGAGAGAGACAGAGTCCCACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-39s1c1
Sequence:CCGGCCCAGGTTCCTGCTCCGGATGCTCGAGCATCCGGAGCAGGAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-38s1c1
Sequence:CCGGTCCCAGGTTCCTGCTCCGGATCTCGAGATCCGGAGCAGGAACCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-48s1c1
Sequence:CCGGCTGCTCCGGATGTGGGACTCTCTCGAGAGAGTCCCACATCCGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-29s1c1
Sequence:CCGGTGCTTCTGCTCCCAGGTTCCTCTCGAGAGGAACCTGGGAGCAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011827
HCST MISSION shRNA Lentiviral Transduction Particles
hematopoietic cell signal transducer
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-54s1c1
Sequence:CCGGCGGATGTGGGACTCTGTCTCTCTCGAGAGAGACAGAGTCCCACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-39s1c1
Sequence:CCGGCCCAGGTTCCTGCTCCGGATGCTCGAGCATCCGGAGCAGGAACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-38s1c1
Sequence:CCGGTCCCAGGTTCCTGCTCCGGATCTCGAGATCCGGAGCAGGAACCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-48s1c1
Sequence:CCGGCTGCTCCGGATGTGGGACTCTCTCGAGAGAGTCCCACATCCGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011827.1-29s1c1
Sequence:CCGGTGCTTCTGCTCCCAGGTTCCTCTCGAGAGGAACCTGGGAGCAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)