EMAIL THIS PAGE TO A FRIEND

HDAC10

histone deacetylase 10

69 Gene Product Result for
Synonyms: HD10
Gene ID:
Human(83933) Summary: The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(170787) histone deacetylase 10
Rat(362981) histone deacetylase 10
sheep(101115701) histone deacetylase 10
domestic guinea pig(100725246) histone deacetylase 10
naked mole-rat(101706833) histone deacetylase 10
Zebrafish(327253) histone deacetylase 10
dog(607032) histone deacetylase 10
cow(510654) histone deacetylase 10
domestic cat(101080901) histone deacetylase 10
chicken(417742) histone deacetylase 10
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032019 Rosetta Predictions human pricing
XM_001053786 Rosetta Predictions rat pricing
XM_001073452 Rosetta Predictions rat pricing
NM_199198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150512 predicted 952
2 SASI_Hs01_00150513 predicted 607
3 SASI_Hs01_00150514 predicted 769
4 SASI_Hs02_00359200 predicted 1347
5 SASI_Hs01_00150515 predicted 622
6 SASI_Hs01_00150516 predicted 1290
7 SASI_Hs02_00359201 predicted 1280
8 SASI_Hs01_00150517 predicted 1817
9 SASI_Hs01_00150519 predicted 1630
10 SASI_Hs01_00150520 predicted 1964
11 SASI_Hs01_00150518 predicted 833
12 SASI_Hs01_00150521 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273552 predicted 1064
2 SASI_Rn02_00273553 predicted 1791
3 SASI_Rn02_00273554 predicted 372
4 SASI_Rn02_00273555 predicted 500
5 SASI_Rn02_00273556 predicted 1481
6 SASI_Rn02_00273557 predicted 1501
7 SASI_Rn02_00273558 predicted 1190
8 SASI_Rn02_00273559 predicted 1110
9 SASI_Rn02_00273560 predicted 574
10 SASI_Rn02_00273561 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342886 predicted 1067
2 SASI_Rn02_00342887 predicted 1796
3 SASI_Rn02_00342888 predicted 376
4 SASI_Rn02_00342889 predicted 498
5 SASI_Rn02_00342890 predicted 1482
6 SASI_Rn02_00342891 predicted 1501
7 SASI_Rn02_00342892 predicted 1183
8 SASI_Rn02_00342893 predicted 1114
9 SASI_Rn02_00342894 predicted 579
10 SASI_Rn02_00342895 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351385 predicted 1979
2 SASI_Mm01_00040703 predicted 1730
3 SASI_Mm01_00040704 predicted 1549
4 SASI_Mm01_00040705 predicted 1581
5 SASI_Mm01_00040706 predicted 436
6 SASI_Mm01_00040707 predicted 765
7 SASI_Mm01_00040708 predicted 802
8 SASI_Mm01_00040709 predicted 1633
9 SASI_Mm01_00040710 predicted 444
10 SASI_Mm01_00040711 predicted 1834
11 SASI_Mm01_00040702 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032019
HDAC10 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1585s1c1
Sequence:CCGGGCACCGCTGTTGCCCTGACAACTCGAGTTGTCAGGGCAACAGCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1103s1c1
Sequence:CCGGCTTTGAGTTTGACCCTGAGCTCTCGAGAGCTCAGGGTCAAACTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-779s1c1
Sequence:CCGGCGGGTTCTGTGTGTTCAACAACTCGAGTTGTTGAACACACAGAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1773s1c1
Sequence:CCGGCAGGTGAACAGTGGTATAGCACTCGAGTGCTATACCACTGTTCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032019.4-2388s1c1
Sequence:CCGGCACCGCAGAAATGACACCGCACTCGAGTGCGGTGTCATTTCTGCGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-2325s1c1
Sequence:CCGGTGGAAGATGTTGCAGTGCCATCTCGAGATGGCACTGCAACATCTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-822s1c1
Sequence:CCGGGCCAAGCAGAAACACGGGCTACTCGAGTAGCCCGTGTTTCTGCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-789s1c1
Sequence:CCGGGTGTTCAACAACGTGGCCATACTCGAGTATGGCCACGTTGTTGAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1742s1c1
Sequence:CCGGCCTGTACCTCTTAGATGGGATCTCGAGATCCCATCTAAGAGGTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032019
HDAC10 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1585s1c1
Sequence:CCGGGCACCGCTGTTGCCCTGACAACTCGAGTTGTCAGGGCAACAGCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1103s1c1
Sequence:CCGGCTTTGAGTTTGACCCTGAGCTCTCGAGAGCTCAGGGTCAAACTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-779s1c1
Sequence:CCGGCGGGTTCTGTGTGTTCAACAACTCGAGTTGTTGAACACACAGAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1773s1c1
Sequence:CCGGCAGGTGAACAGTGGTATAGCACTCGAGTGCTATACCACTGTTCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032019.4-2388s1c1
Sequence:CCGGCACCGCAGAAATGACACCGCACTCGAGTGCGGTGTCATTTCTGCGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-2325s1c1
Sequence:CCGGTGGAAGATGTTGCAGTGCCATCTCGAGATGGCACTGCAACATCTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-822s1c1
Sequence:CCGGGCCAAGCAGAAACACGGGCTACTCGAGTAGCCCGTGTTTCTGCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-789s1c1
Sequence:CCGGGTGTTCAACAACGTGGCCATACTCGAGTATGGCCACGTTGTTGAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1742s1c1
Sequence:CCGGCCTGTACCTCTTAGATGGGATCTCGAGATCCCATCTAAGAGGTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032019
HDAC10 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1585s1c1
Sequence:CCGGGCACCGCTGTTGCCCTGACAACTCGAGTTGTCAGGGCAACAGCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1103s1c1
Sequence:CCGGCTTTGAGTTTGACCCTGAGCTCTCGAGAGCTCAGGGTCAAACTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-779s1c1
Sequence:CCGGCGGGTTCTGTGTGTTCAACAACTCGAGTTGTTGAACACACAGAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1773s1c1
Sequence:CCGGCAGGTGAACAGTGGTATAGCACTCGAGTGCTATACCACTGTTCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032019.4-2388s1c1
Sequence:CCGGCACCGCAGAAATGACACCGCACTCGAGTGCGGTGTCATTTCTGCGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-2325s1c1
Sequence:CCGGTGGAAGATGTTGCAGTGCCATCTCGAGATGGCACTGCAACATCTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-822s1c1
Sequence:CCGGGCCAAGCAGAAACACGGGCTACTCGAGTAGCCCGTGTTTCTGCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-789s1c1
Sequence:CCGGGTGTTCAACAACGTGGCCATACTCGAGTATGGCCACGTTGTTGAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032019.4-1742s1c1
Sequence:CCGGCCTGTACCTCTTAGATGGGATCTCGAGATCCCATCTAAGAGGTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199198
HDAC10 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1883s1c1
Sequence:CCGGCCAGCCTGATATGGTGTTGATCTCGAGATCAACACCATATCAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1638s1c1
Sequence:CCGGGCAACATTGGATGTACTCATTCTCGAGAATGAGTACATCCAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-885s1c1
Sequence:CCGGGCCGACTATTTGGCTGCCTTTCTCGAGAAAGGCAGCCAAATAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-2105s1c1
Sequence:CCGGCCAGGCTCTGATGTTTCTAAACTCGAGTTTAGAAACATCAGAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-432s1c1
Sequence:CCGGGCACTGTCTAAGCAGTACGATCTCGAGATCGTACTGCTTAGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199198
HDAC10 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1883s1c1
Sequence:CCGGCCAGCCTGATATGGTGTTGATCTCGAGATCAACACCATATCAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1638s1c1
Sequence:CCGGGCAACATTGGATGTACTCATTCTCGAGAATGAGTACATCCAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-885s1c1
Sequence:CCGGGCCGACTATTTGGCTGCCTTTCTCGAGAAAGGCAGCCAAATAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-2105s1c1
Sequence:CCGGCCAGGCTCTGATGTTTCTAAACTCGAGTTTAGAAACATCAGAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-432s1c1
Sequence:CCGGGCACTGTCTAAGCAGTACGATCTCGAGATCGTACTGCTTAGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199198
HDAC10 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1883s1c1
Sequence:CCGGCCAGCCTGATATGGTGTTGATCTCGAGATCAACACCATATCAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-1638s1c1
Sequence:CCGGGCAACATTGGATGTACTCATTCTCGAGAATGAGTACATCCAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-885s1c1
Sequence:CCGGGCCGACTATTTGGCTGCCTTTCTCGAGAAAGGCAGCCAAATAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-2105s1c1
Sequence:CCGGCCAGGCTCTGATGTTTCTAAACTCGAGTTTAGAAACATCAGAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199198.1-432s1c1
Sequence:CCGGGCACTGTCTAAGCAGTACGATCTCGAGATCGTACTGCTTAGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)