EMAIL THIS PAGE TO A FRIEND

HDAC11

histone deacetylase 11

51 Gene Product Result for
Synonyms: HD11
UniProtKB ID: Q96DB2, B4DDK1, Q9H6I7, Q9H6X3, Q9NTC9
Gene ID:
Human(79885) Summary: This gene encodes a class IV histone deacetylase. The encoded protein is localized to the nucleus and may be involved in regulating the expression of interleukin 10. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009]
Mouse(232232) histone deacetylase 11
Rat(297453) histone deacetylase 11
Zebrafish(431718) histone deacetylase 11
cow(519899) histone deacetylase 11
domestic cat(101081876) histone deacetylase 11
dog(484633) histone deacetylase 11
chicken(415978) histone deacetylase 11
domestic guinea pig(100715203) histone deacetylase 11
naked mole-rat(101726705) histone deacetylase 11
sheep(101110455) histone deacetylase 11
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024827 Rosetta Predictions human pricing
NM_001106610 Rosetta Predictions rat pricing
NM_144919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141212 predicted 1459
2 SASI_Hs01_00141213 predicted 1332
3 SASI_Hs01_00141214 predicted 482
4 SASI_Hs01_00141215 predicted 491
5 SASI_Hs01_00141216 predicted 1454
6 SASI_Hs01_00141217 predicted 472
7 SASI_Hs01_00141218 predicted 955
8 SASI_Hs01_00141219 predicted 957
9 SASI_Hs01_00141220 predicted 952
10 SASI_Hs02_00357389 predicted 1337
11 SASI_Hs01_00141211 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220638 predicted 793
2 SASI_Rn02_00220639 predicted 1536
3 SASI_Rn02_00220640 predicted 1537
4 SASI_Rn02_00220641 predicted 1469
5 SASI_Rn02_00220642 predicted 1421
6 SASI_Rn02_00220643 predicted 627
7 SASI_Rn02_00220644 predicted 621
8 SASI_Rn02_00220645 predicted 1547
9 SASI_Rn02_00220646 predicted 1514
10 SASI_Rn02_00220647 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123733 predicted 616
2 SASI_Mm01_00123735 predicted 503
3 SASI_Mm02_00340407 predicted 611
4 SASI_Mm01_00123736 predicted 278
5 SASI_Mm01_00123737 predicted 584
6 SASI_Mm02_00340408 predicted 605
7 SASI_Mm01_00123738 predicted 259
8 SASI_Mm01_00123739 predicted 1518
9 SASI_Mm01_00123740 predicted 578
10 SASI_Mm01_00123741 predicted 506
11 SASI_Mm01_00123734 predicted 779
12 SASI_Mm01_00123742 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144919
HDAC11 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 11
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-554s1c1
Sequence:CCGGGCCACCATCATTGATCTCGATCTCGAGATCGAGATCAATGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-620s1c1
Sequence:CCGGCGAGTATACATCATGGATGTTCTCGAGAACATCCATGATGTATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-262s1c1
Sequence:CCGGGCGCTATCTCAACGAGCTGAACTCGAGTTCAGCTCGTTGAGATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-904s1c1
Sequence:CCGGCCATGATATACCCATCCTCATCTCGAGATGAGGATGGGTATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-85s1c1
Sequence:CCGGCGTGTACTCACCACGTTACAACTCGAGTTGTAACGTGGTGAGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-607s21c1
Sequence:CCGGCATGGGTGACAAGCGAGTATACTCGAGTATACTCGCTTGTCACCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-946s21c1
Sequence:CCGGGAAGCGCACAGCCCGTATTATCTCGAGATAATACGGGCTGTGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-894s21c1
Sequence:CCGGTGGTCCGAGCCCATGATATACCTCGAGGTATATCATGGGCTCGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1362s21c1
Sequence:CCGGAGAGTCGTTTGCTGTTCATATCTCGAGATATGAACAGCAAACGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-499s21c1
Sequence:CCGGAGACATCACACTGGCTATCAACTCGAGTTGATAGCCAGTGTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-1075s21c1
Sequence:CCGGACGGCTACTCACAGAACATTGCTCGAGCAATGTTCTGTGAGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1412s21c1
Sequence:CCGGTTGGCTTACTTCCTCACTTTACTCGAGTAAAGTGAGGAAGTAAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144919
HDAC11 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 11
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-554s1c1
Sequence:CCGGGCCACCATCATTGATCTCGATCTCGAGATCGAGATCAATGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-620s1c1
Sequence:CCGGCGAGTATACATCATGGATGTTCTCGAGAACATCCATGATGTATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-262s1c1
Sequence:CCGGGCGCTATCTCAACGAGCTGAACTCGAGTTCAGCTCGTTGAGATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-904s1c1
Sequence:CCGGCCATGATATACCCATCCTCATCTCGAGATGAGGATGGGTATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-85s1c1
Sequence:CCGGCGTGTACTCACCACGTTACAACTCGAGTTGTAACGTGGTGAGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-607s21c1
Sequence:CCGGCATGGGTGACAAGCGAGTATACTCGAGTATACTCGCTTGTCACCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-946s21c1
Sequence:CCGGGAAGCGCACAGCCCGTATTATCTCGAGATAATACGGGCTGTGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-894s21c1
Sequence:CCGGTGGTCCGAGCCCATGATATACCTCGAGGTATATCATGGGCTCGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1362s21c1
Sequence:CCGGAGAGTCGTTTGCTGTTCATATCTCGAGATATGAACAGCAAACGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-499s21c1
Sequence:CCGGAGACATCACACTGGCTATCAACTCGAGTTGATAGCCAGTGTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-1075s21c1
Sequence:CCGGACGGCTACTCACAGAACATTGCTCGAGCAATGTTCTGTGAGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1412s21c1
Sequence:CCGGTTGGCTTACTTCCTCACTTTACTCGAGTAAAGTGAGGAAGTAAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144919
HDAC11 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 11
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-554s1c1
Sequence:CCGGGCCACCATCATTGATCTCGATCTCGAGATCGAGATCAATGATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-620s1c1
Sequence:CCGGCGAGTATACATCATGGATGTTCTCGAGAACATCCATGATGTATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-262s1c1
Sequence:CCGGGCGCTATCTCAACGAGCTGAACTCGAGTTCAGCTCGTTGAGATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-904s1c1
Sequence:CCGGCCATGATATACCCATCCTCATCTCGAGATGAGGATGGGTATATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144919.1-85s1c1
Sequence:CCGGCGTGTACTCACCACGTTACAACTCGAGTTGTAACGTGGTGAGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-607s21c1
Sequence:CCGGCATGGGTGACAAGCGAGTATACTCGAGTATACTCGCTTGTCACCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-946s21c1
Sequence:CCGGGAAGCGCACAGCCCGTATTATCTCGAGATAATACGGGCTGTGCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-894s21c1
Sequence:CCGGTGGTCCGAGCCCATGATATACCTCGAGGTATATCATGGGCTCGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1362s21c1
Sequence:CCGGAGAGTCGTTTGCTGTTCATATCTCGAGATATGAACAGCAAACGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-499s21c1
Sequence:CCGGAGACATCACACTGGCTATCAACTCGAGTTGATAGCCAGTGTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144919.2-1075s21c1
Sequence:CCGGACGGCTACTCACAGAACATTGCTCGAGCAATGTTCTGTGAGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144919.2-1412s21c1
Sequence:CCGGTTGGCTTACTTCCTCACTTTACTCGAGTAAAGTGAGGAAGTAAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024827
VALIDATED
HDAC11 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 11
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-255s1c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-502s1c1
Sequence:CCGGCTCGCCATCAAGTTTCTGTTTCTCGAGAAACAGAAACTTGATGGCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-952s1c1
Sequence:CCGGCGCATCATTGCTGACTCCATACTCGAGTATGGAGTCAGCAATGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-152s1c1
Sequence:CCGGGCAAAGTGATCAATTTCCTAACTCGAGTTAGGAAATTGATCACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-964s1c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-907s1c1
Sequence:CCGGCCCATCCTTATGGTGACCTCACTCGAGTGAGGTCACCATAAGGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-330s1c1
Sequence:CCGGCAACTTCCTTGTGCAGAGGAACTCGAGTTCCTCTGCACAAGGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-775s1c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-555s1c1
Sequence:CCGGCATTGATCTTGATGCCCATCACTCGAGTGATGGGCATCAAGATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-372s1c1
Sequence:CCGGCCAGACAGGAGGAACCATAATCTCGAGATTATGGTTCCTCCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1617s21c1
Sequence:GTACCGGTGGGATTTGCTGCCCTCTTTGCTCGAGCAAAGAGGGCAGCAAATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1639s21c1
Sequence:CCGGCCCAGAGCTGAAGAGCTATAGCTCGAGCTATAGCTCTTCAGCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1073s21c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024827.3-884s21c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-364s21c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-622s21c1
Sequence:CCGGGTTTCTGTTTGAGCGTGTGGACTCGAGTCCACACGCTCAAACAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024827
VALIDATED
HDAC11 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 11
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-255s1c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-502s1c1
Sequence:CCGGCTCGCCATCAAGTTTCTGTTTCTCGAGAAACAGAAACTTGATGGCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-952s1c1
Sequence:CCGGCGCATCATTGCTGACTCCATACTCGAGTATGGAGTCAGCAATGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-152s1c1
Sequence:CCGGGCAAAGTGATCAATTTCCTAACTCGAGTTAGGAAATTGATCACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-964s1c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-907s1c1
Sequence:CCGGCCCATCCTTATGGTGACCTCACTCGAGTGAGGTCACCATAAGGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-330s1c1
Sequence:CCGGCAACTTCCTTGTGCAGAGGAACTCGAGTTCCTCTGCACAAGGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-775s1c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-555s1c1
Sequence:CCGGCATTGATCTTGATGCCCATCACTCGAGTGATGGGCATCAAGATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-372s1c1
Sequence:CCGGCCAGACAGGAGGAACCATAATCTCGAGATTATGGTTCCTCCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1617s21c1
Sequence:GTACCGGTGGGATTTGCTGCCCTCTTTGCTCGAGCAAAGAGGGCAGCAAATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1639s21c1
Sequence:CCGGCCCAGAGCTGAAGAGCTATAGCTCGAGCTATAGCTCTTCAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1073s21c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024827.3-884s21c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-364s21c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-622s21c1
Sequence:CCGGGTTTCTGTTTGAGCGTGTGGACTCGAGTCCACACGCTCAAACAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024827
VALIDATED
HDAC11 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 11
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-255s1c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-502s1c1
Sequence:CCGGCTCGCCATCAAGTTTCTGTTTCTCGAGAAACAGAAACTTGATGGCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-952s1c1
Sequence:CCGGCGCATCATTGCTGACTCCATACTCGAGTATGGAGTCAGCAATGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-152s1c1
Sequence:CCGGGCAAAGTGATCAATTTCCTAACTCGAGTTAGGAAATTGATCACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-964s1c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-907s1c1
Sequence:CCGGCCCATCCTTATGGTGACCTCACTCGAGTGAGGTCACCATAAGGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-330s1c1
Sequence:CCGGCAACTTCCTTGTGCAGAGGAACTCGAGTTCCTCTGCACAAGGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024827.1-775s1c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024827.1-555s1c1
Sequence:CCGGCATTGATCTTGATGCCCATCACTCGAGTGATGGGCATCAAGATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024827.1-372s1c1
Sequence:CCGGCCAGACAGGAGGAACCATAATCTCGAGATTATGGTTCCTCCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1617s21c1
Sequence:GTACCGGTGGGATTTGCTGCCCTCTTTGCTCGAGCAAAGAGGGCAGCAAATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1639s21c1
Sequence:CCGGCCCAGAGCTGAAGAGCTATAGCTCGAGCTATAGCTCTTCAGCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-1073s21c1
Sequence:CCGGGACTCCATACTTAATCTGTTTCTCGAGAAACAGATTAAGTATGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024827.3-884s21c1
Sequence:CCGGCCCGACGTGGTGGTATACAATCTCGAGATTGTATACCACCACGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-364s21c1
Sequence:CCGGGCGCTATCTTAATGAGCTCAACTCGAGTTGAGCTCATTAAGATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024827.3-622s21c1
Sequence:CCGGGTTTCTGTTTGAGCGTGTGGACTCGAGTCCACACGCTCAAACAGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)