EMAIL THIS PAGE TO A FRIEND

HDAC1

histone deacetylase 1

103 Gene Product Result for
Synonyms: GON-10 HD1 RPD3 RPD3L1
UniProtKB ID: Q13547, Q92534
Gene ID:
Human(3065) Summary: Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]
Mouse(433759) histone deacetylase 1
Rat(297893) histone deacetylase 1
Zebrafish(192302) histone deacetylase 1
chicken(373961) histone deacetylase 1
dog(487309) histone deacetylase 1
domestic cat(101099228) histone deacetylase 1
cow(404126) histone deacetylase 1
domestic guinea pig(100728529) histone deacetylase 1
naked mole-rat(101715102) histone deacetylase 1
sheep(100820752) histone deacetylase 1
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501930 Anti-HDAC1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB2502051 Anti-Hdac1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, rat, human, mouse, bovine
ELISA, western blot pricing
SAB2701686 Anti-hdac1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2701822 Anti-hdac1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV38530 Anti-HDAC1 antibody produced in rabbit IgG fraction of antiserum horse, human, rat, canine, rabbit, bovine, mouse, guinea pig
western blot pricing
SAB2101020 Anti-HDAC1 antibody produced in rabbit affinity isolated antibody , bovine, canine, guinea pig, human, mouse, rabbit, rat, zebrafish, horse
immunohistochemistry, western blot pricing
HPA029693 Anti-HDAC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501382 Anti-HDAC1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501383 Anti-HDAC1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H3284 Anti-Histone Deacetylase 1 (HDAC1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
H6287 Anti-Histone Deacetylase 1 (HDAC1) antibody, Mouse monoclonal clone HDAC1-21, purified from hybridoma cell culture mouse, human
ELISA, immunoprecipitation (IP), microarray, western blot pricing
SAB4504093 Anti-phospho-HDAC1 (pSer421) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301533 Anti-phospho-HDAC1 (pSer421) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4800014 Imprint® Anti-HDAC1, (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800019 Imprint® Monoclonal Anti-HDAC1, (C-terminal) antibody produced in mouse affinity isolated antibody, buffered aqueous solution human
ChIP, western blot pricing
WH0003065M2 Monoclonal Anti-HDAC1 antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400120 Monoclonal Anti-HDAC1 antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400121 Monoclonal Anti-HDAC1 antibody produced in mouse clone 5C11, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1403911 Monoclonal Anti-HDAC1 antibody produced in mouse clone 5A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AMAB90781 Monoclonal Anti-HDAC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0510, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation rat, mouse, human
immunohistochemistry, western blot pricing
PLA0134 Rabbit anti-HDAC1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, marmoset, mouse, human, rabbit, horse, Chinese hamster, rabbit, bovine, chimpanzee, rhesus monkey, primate
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
B103500 Butyric acid ≥99% human pricing
W222100 Butyric acid ≥99%, FG human pricing
W222119 Butyric acid natural, ≥99%, FCC, FG human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P6273 2-Propylpentanoic acid human, mouse, rat pricing
T8552 Trichostatin A ≥98% (HPLC), from Streptomyces sp. human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025841 MISSION® esiRNA esiRNA human HDAC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004964 siRNAs that have been validated in the lab human pricing
NM_001025409 Rosetta Predictions rat pricing
NM_008228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004964 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079968 validated 869
2 SASI_Hs01_00079964 predicted 566
3 SASI_Hs01_00079965 predicted 1120
4 SASI_Hs01_00079966 predicted 710
5 SASI_Hs01_00079969 predicted 872
6 SASI_Hs01_00079970 predicted 927
7 SASI_Hs01_00079971 predicted 419
8 SASI_Hs01_00079972 predicted 297
9 SASI_Hs01_00079973 predicted 918
10 SASI_Hs02_00338653 predicted 873
11 SASI_Hs01_00079967 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056573 predicted 999
2 SASI_Rn01_00056574 predicted 317
3 SASI_Rn01_00056575 predicted 830
4 SASI_Rn01_00056576 predicted 1015
5 SASI_Rn01_00056577 predicted 524
6 SASI_Rn01_00056578 predicted 995
7 SASI_Rn01_00056579 predicted 996
8 SASI_Rn01_00056580 predicted 252
9 SASI_Rn01_00056581 predicted 925
10 SASI_Rn01_00056582 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313417 predicted 319
2 SASI_Mm01_00159502 predicted 720
3 SASI_Mm01_00159497 predicted 246
4 SASI_Mm01_00159498 predicted 713
5 SASI_Mm01_00159499 predicted 323
6 SASI_Mm01_00159500 predicted 704
7 SASI_Mm01_00159501 predicted 995
8 SASI_Mm01_00159503 predicted 1038
9 SASI_Mm01_00159504 predicted 383
10 SASI_Mm01_00159505 predicted 260
11 SASI_Mm01_00159506 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004964
VALIDATED
HDAC1 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-871s21c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004964.2-1717s21c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-186s21c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1036s21c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1353s21c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-1717s1c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-186s1c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1353s1c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-789s1c1
Sequence:CCGGGCCGGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1774s1c1
Sequence:CCGGGCAACCATAAGACAAACTCCTCTCGAGAGGAGTTTGTCTTATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004964.2-1820s1c1
Sequence:CCGGCTTTGGAAAGGTGCCCTTATTCTCGAGAATAAGGGCACCTTTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-871s1c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1036s1c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-264s1c1
Sequence:CCGGCCACAGCGATGACTACATTAACTCGAGTTAATGTAGTCATCGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-719s1c1
Sequence:CCGGGCAAGTATTATGCTGTTAACTCTCGAGAGTTAACAGCATAATACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-709s1c1
Sequence:CCGGGCTGGCAAAGGCAAGTATTATCTCGAGATAATACTTGCCTTTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1143s1c1
Sequence:CCGGGAAGATCAAACAGCGACTGTTCTCGAGAACAGTCGCTGTTTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004964
VALIDATED
HDAC1 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-871s21c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004964.2-1717s21c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-186s21c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1036s21c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1353s21c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-1717s1c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-186s1c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1353s1c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-789s1c1
Sequence:CCGGGCCGGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1774s1c1
Sequence:CCGGGCAACCATAAGACAAACTCCTCTCGAGAGGAGTTTGTCTTATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004964.2-1820s1c1
Sequence:CCGGCTTTGGAAAGGTGCCCTTATTCTCGAGAATAAGGGCACCTTTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-871s1c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1036s1c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-264s1c1
Sequence:CCGGCCACAGCGATGACTACATTAACTCGAGTTAATGTAGTCATCGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-719s1c1
Sequence:CCGGGCAAGTATTATGCTGTTAACTCTCGAGAGTTAACAGCATAATACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-709s1c1
Sequence:CCGGGCTGGCAAAGGCAAGTATTATCTCGAGATAATACTTGCCTTTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1143s1c1
Sequence:CCGGGAAGATCAAACAGCGACTGTTCTCGAGAACAGTCGCTGTTTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004964
VALIDATED
HDAC1 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-871s21c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004964.2-1717s21c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-186s21c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1036s21c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004964.2-1353s21c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-1717s1c1
Sequence:CCGGCGTTCTTAACTTTGAACCATACTCGAGTATGGTTCAAAGTTAAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-186s1c1
Sequence:CCGGGCTGCTCAACTATGGTCTCTACTCGAGTAGAGACCATAGTTGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1353s1c1
Sequence:CCGGCCGCAAGAACTCTTCCAACTTCTCGAGAAGTTGGAAGAGTTCTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-789s1c1
Sequence:CCGGGCCGGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1774s1c1
Sequence:CCGGGCAACCATAAGACAAACTCCTCTCGAGAGGAGTTTGTCTTATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004964.2-1820s1c1
Sequence:CCGGCTTTGGAAAGGTGCCCTTATTCTCGAGAATAAGGGCACCTTTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004964.2-871s1c1
Sequence:CCGGCGGTTAGGTTGCTTCAATCTACTCGAGTAGATTGAAGCAACCTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1036s1c1
Sequence:CCGGCCTAATGAGCTTCCATACAATCTCGAGATTGTATGGAAGCTCATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-264s1c1
Sequence:CCGGCCACAGCGATGACTACATTAACTCGAGTTAATGTAGTCATCGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-719s1c1
Sequence:CCGGGCAAGTATTATGCTGTTAACTCTCGAGAGTTAACAGCATAATACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004964.2-709s1c1
Sequence:CCGGGCTGGCAAAGGCAAGTATTATCTCGAGATAATACTTGCCTTTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004964.2-1143s1c1
Sequence:CCGGGAAGATCAAACAGCGACTGTTCTCGAGAACAGTCGCTGTTTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008228
VALIDATED
HDAC1 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-69s21c1
Sequence:CCGGGATGTTGGAAACTACTATTATCTCGAGATAATAGTAGTTTCCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-516s21c1
Sequence:CCGGCACCAGAGGGTGCTCTATATTCTCGAGAATATAGAGCACCCTCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-1019s21c1
Sequence:GTACCGGTGAATACTTTGGACCGGATTTCTCGAGAAATCCGGTCCAAAGTATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008228.2-120s21c1
Sequence:CCGGATCCGCATGACTCACAATTTGCTCGAGCAAATTGTGAGTCATGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-1784s1c1
Sequence:CCGGGCTTGGGTAATAGCAGCCATTCTCGAGAATGGCTGCTATTACCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-743s1c1
Sequence:CCGGGCCAGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-245s1c1
Sequence:CCGGGCGTTCTATTCGCCCAGATAACTCGAGTTATCTGGGCGAATAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-1002s1c1
Sequence:CCGGCCCTACAATGACTACTTTGAACTCGAGTTCAAAGTAGTCATTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-318s1c1
Sequence:CCGGCCGGTATTTGATGGCTTGTTTCTCGAGAAACAAGCCATCAAATACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008228
VALIDATED
HDAC1 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-69s21c1
Sequence:CCGGGATGTTGGAAACTACTATTATCTCGAGATAATAGTAGTTTCCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-516s21c1
Sequence:CCGGCACCAGAGGGTGCTCTATATTCTCGAGAATATAGAGCACCCTCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-1019s21c1
Sequence:GTACCGGTGAATACTTTGGACCGGATTTCTCGAGAAATCCGGTCCAAAGTATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008228.2-120s21c1
Sequence:CCGGATCCGCATGACTCACAATTTGCTCGAGCAAATTGTGAGTCATGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-1784s1c1
Sequence:CCGGGCTTGGGTAATAGCAGCCATTCTCGAGAATGGCTGCTATTACCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-743s1c1
Sequence:CCGGGCCAGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-245s1c1
Sequence:CCGGGCGTTCTATTCGCCCAGATAACTCGAGTTATCTGGGCGAATAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-1002s1c1
Sequence:CCGGCCCTACAATGACTACTTTGAACTCGAGTTCAAAGTAGTCATTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-318s1c1
Sequence:CCGGCCGGTATTTGATGGCTTGTTTCTCGAGAAACAAGCCATCAAATACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008228
VALIDATED
HDAC1 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-69s21c1
Sequence:CCGGGATGTTGGAAACTACTATTATCTCGAGATAATAGTAGTTTCCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-516s21c1
Sequence:CCGGCACCAGAGGGTGCTCTATATTCTCGAGAATATAGAGCACCCTCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008228.2-1019s21c1
Sequence:GTACCGGTGAATACTTTGGACCGGATTTCTCGAGAAATCCGGTCCAAAGTATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008228.2-120s21c1
Sequence:CCGGATCCGCATGACTCACAATTTGCTCGAGCAAATTGTGAGTCATGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-1784s1c1
Sequence:CCGGGCTTGGGTAATAGCAGCCATTCTCGAGAATGGCTGCTATTACCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-743s1c1
Sequence:CCGGGCCAGTCATGTCCAAAGTAATCTCGAGATTACTTTGGACATGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008228.1-245s1c1
Sequence:CCGGGCGTTCTATTCGCCCAGATAACTCGAGTTATCTGGGCGAATAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-1002s1c1
Sequence:CCGGCCCTACAATGACTACTTTGAACTCGAGTTCAAAGTAGTCATTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008228.1-318s1c1
Sequence:CCGGCCGGTATTTGATGGCTTGTTTCTCGAGAAACAAGCCATCAAATACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)