EMAIL THIS PAGE TO A FRIEND

HDAC2

histone deacetylase 2

108 Gene Product Result for
Synonyms: HD2 RPD3 YAF1
UniProtKB ID: Q92769, B4DL58, E1P561, Q5SRI8, Q5SZ86, Q8NEH4
Gene ID:
Human(3066) Summary: This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Mouse(15182) histone deacetylase 2
Rat(84577) histone deacetylase 2
chicken(395635) histone deacetylase 2
domestic cat(101088165) histone deacetylase 2
cow(407223) histone deacetylase 2
dog(475035) histone deacetylase 2
domestic guinea pig(100715675) histone deacetylase 2
naked mole-rat(101712029) histone deacetylase 2
sheep(101107708) histone deacetylase 2
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300412 Anti-HDAC2 (Ab-394) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA011727 Anti-HDAC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV32618 Anti-HDAC2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2104633 Anti-HDAC2 antibody produced in rabbit affinity isolated antibody human
ChIP, immunohistochemistry, western blot pricing
SAB4501384 Anti-HDAC2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
H3159 Anti-Histone Deacetylase 2 (HDAC2) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
H2663 Anti-Histone Deacetylase 2 (HDAC2) antibody, Mouse monoclonal clone HDAC2-62, purified from hybridoma cell culture canine, mouse, rat, chicken, human, bovine
ELISA, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4300154 Anti-phospho-HDAC2 (pSer394) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504421 Anti-phospho-HDAC2 (pSer394) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001527 siRNAs that have been validated in the lab human pricing
XM_001061582 Rosetta Predictions rat pricing
XM_342149 Rosetta Predictions rat pricing
NM_008229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001527 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142115 validated 784
2 SASI_Hs02_00332058 predicted 1209
3 SASI_Hs01_00142116 predicted 763
4 SASI_Hs01_00142118 predicted 782
5 SASI_Hs02_00332059 predicted 577
6 SASI_Hs01_00142122 predicted 691
7 SASI_Hs01_00142119 predicted 1336
8 SASI_Hs01_00142121 predicted 1250
9 SASI_Hs02_00332060 predicted 732
10 SASI_Hs01_00142123 predicted 643
11 SASI_Hs02_00332061 predicted 1314
12 SASI_Hs01_00142117 predicted 915
13 SASI_Hs01_00142120 predicted 513
14 SASI_Hs01_00142124 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300566 predicted 636
2 SASI_Rn02_00300567 predicted 1723
3 SASI_Rn02_00300568 predicted 1564
4 SASI_Rn02_00300569 predicted 1064
5 SASI_Rn02_00300570 predicted 417
6 SASI_Rn02_00300571 predicted 1332
7 SASI_Rn02_00300572 predicted 947
8 SASI_Rn02_00300573 predicted 1201
9 SASI_Rn02_00300574 predicted 1047
10 SASI_Rn02_00300575 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393824 predicted 640
2 SASI_Rn02_00393825 predicted 1722
3 SASI_Rn02_00393826 predicted 1566
4 SASI_Rn02_00393827 predicted 1062
5 SASI_Rn02_00393828 predicted 414
6 SASI_Rn02_00393829 predicted 1335
7 SASI_Rn02_00393830 predicted 949
8 SASI_Rn02_00393831 predicted 1202
9 SASI_Rn02_00393832 predicted 1051
10 SASI_Rn02_00393833 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100698 predicted 330
2 SASI_Mm01_00100699 predicted 511
3 SASI_Mm01_00100700 predicted 1567
4 SASI_Mm01_00100701 predicted 1177
5 SASI_Mm01_00100702 predicted 607
6 SASI_Mm01_00100703 predicted 687
7 SASI_Mm01_00100704 predicted 1239
8 SASI_Mm01_00100705 predicted 398
9 SASI_Mm01_00100706 predicted 1524
10 SASI_Mm01_00100707 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008229
VALIDATED
HDAC2 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1144s1c1
Sequence:CCGGCCCAATGAGTTGCCATATAATCTCGAGATTATATGGCAACTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-400s1c1
Sequence:CCGGCGATCAATAAGACCAGATAATCTCGAGATTATCTGGTCTTATTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1393s1c1
Sequence:CCGGCGAGCATCAGACAAACGGATACTCGAGTATCCGTTTGTCTGATGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008229.1-532s1c1
Sequence:CCGGGCTGTGAAATTAAACCGGCAACTCGAGTTGCCGGTTTAATTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008229.2-1712s21c1
Sequence:CCGGGACGATTCTGGGATAAGAAACCTCGAGGTTTCTTATCCCAGAATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-259s21c1
Sequence:CCGGTGGTGATATTGGCAATTATTACTCGAGTAATAATTGCCAATATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-902s21c1
Sequence:CCGGGGTATAGATGATGAATCATATCTCGAGATATGATTCATCATCTATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008229
VALIDATED
HDAC2 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1144s1c1
Sequence:CCGGCCCAATGAGTTGCCATATAATCTCGAGATTATATGGCAACTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-400s1c1
Sequence:CCGGCGATCAATAAGACCAGATAATCTCGAGATTATCTGGTCTTATTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1393s1c1
Sequence:CCGGCGAGCATCAGACAAACGGATACTCGAGTATCCGTTTGTCTGATGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008229.1-532s1c1
Sequence:CCGGGCTGTGAAATTAAACCGGCAACTCGAGTTGCCGGTTTAATTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008229.2-1712s21c1
Sequence:CCGGGACGATTCTGGGATAAGAAACCTCGAGGTTTCTTATCCCAGAATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-259s21c1
Sequence:CCGGTGGTGATATTGGCAATTATTACTCGAGTAATAATTGCCAATATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-902s21c1
Sequence:CCGGGGTATAGATGATGAATCATATCTCGAGATATGATTCATCATCTATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008229
VALIDATED
HDAC2 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1144s1c1
Sequence:CCGGCCCAATGAGTTGCCATATAATCTCGAGATTATATGGCAACTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-400s1c1
Sequence:CCGGCGATCAATAAGACCAGATAATCTCGAGATTATCTGGTCTTATTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008229.1-1393s1c1
Sequence:CCGGCGAGCATCAGACAAACGGATACTCGAGTATCCGTTTGTCTGATGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008229.1-532s1c1
Sequence:CCGGGCTGTGAAATTAAACCGGCAACTCGAGTTGCCGGTTTAATTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008229.2-1712s21c1
Sequence:CCGGGACGATTCTGGGATAAGAAACCTCGAGGTTTCTTATCCCAGAATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-259s21c1
Sequence:CCGGTGGTGATATTGGCAATTATTACTCGAGTAATAATTGCCAATATCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008229.2-902s21c1
Sequence:CCGGGGTATAGATGATGAATCATATCTCGAGATATGATTCATCATCTATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001527
VALIDATED
HDAC2 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1678s1c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-994s1c1
Sequence:CCGGGCAGACTCATTATCTGGTGATCTCGAGATCACCAGATAATGAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-667s21c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-508s1c1
Sequence:CCGGCCAGCGTTTGATGGACTCTTTCTCGAGAAAGAGTCCATCAAACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-933s1c1
Sequence:CCGGGCCTATTATCTCAAAGGTGATCTCGAGATCACCTTTGAGATAATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-863s1c1
Sequence:CCGGGCAAATACTATGCTGTCAATTCTCGAGAATTGACAGCATAGTATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1129s1c1
Sequence:CCGGGTTGCTCGATGTTGGACATATCTCGAGATATGTCCAACATCGAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-243s1c1
Sequence:CCGGCTACTACTACGACGGTGATATCTCGAGATATCACCGTCGTAGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001527.2-1756s21c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-867s21c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-1037s1c1
Sequence:CCGGCAGTCAAAGGTCATGCTAAATCTCGAGATTTAGCATGACCTTTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-589s1c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-253s1c1
Sequence:CCGGGACGGTGATATTGGAAATTATCTCGAGATAATTTCCAATATCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-789s1c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-568s1c1
Sequence:CCGGGCTGTGAAGTTAAACCGACAACTCGAGTTGTCGGTTTAACTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001527
VALIDATED
HDAC2 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1678s1c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-994s1c1
Sequence:CCGGGCAGACTCATTATCTGGTGATCTCGAGATCACCAGATAATGAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-667s21c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-508s1c1
Sequence:CCGGCCAGCGTTTGATGGACTCTTTCTCGAGAAAGAGTCCATCAAACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-933s1c1
Sequence:CCGGGCCTATTATCTCAAAGGTGATCTCGAGATCACCTTTGAGATAATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-863s1c1
Sequence:CCGGGCAAATACTATGCTGTCAATTCTCGAGAATTGACAGCATAGTATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1129s1c1
Sequence:CCGGGTTGCTCGATGTTGGACATATCTCGAGATATGTCCAACATCGAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-243s1c1
Sequence:CCGGCTACTACTACGACGGTGATATCTCGAGATATCACCGTCGTAGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001527.2-1756s21c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-867s21c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-1037s1c1
Sequence:CCGGCAGTCAAAGGTCATGCTAAATCTCGAGATTTAGCATGACCTTTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-589s1c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-253s1c1
Sequence:CCGGGACGGTGATATTGGAAATTATCTCGAGATAATTTCCAATATCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-789s1c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-568s1c1
Sequence:CCGGGCTGTGAAGTTAAACCGACAACTCGAGTTGTCGGTTTAACTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001527
VALIDATED
HDAC2 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1678s1c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-994s1c1
Sequence:CCGGGCAGACTCATTATCTGGTGATCTCGAGATCACCAGATAATGAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-667s21c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-508s1c1
Sequence:CCGGCCAGCGTTTGATGGACTCTTTCTCGAGAAAGAGTCCATCAAACGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-933s1c1
Sequence:CCGGGCCTATTATCTCAAAGGTGATCTCGAGATCACCTTTGAGATAATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-863s1c1
Sequence:CCGGGCAAATACTATGCTGTCAATTCTCGAGAATTGACAGCATAGTATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-1129s1c1
Sequence:CCGGGTTGCTCGATGTTGGACATATCTCGAGATATGTCCAACATCGAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-243s1c1
Sequence:CCGGCTACTACTACGACGGTGATATCTCGAGATATCACCGTCGTAGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001527.2-1756s21c1
Sequence:CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001527.2-867s21c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001527.1-1037s1c1
Sequence:CCGGCAGTCAAAGGTCATGCTAAATCTCGAGATTTAGCATGACCTTTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-589s1c1
Sequence:CCGGCAGACTGATATGGCTGTTAATCTCGAGATTAACAGCCATATCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-253s1c1
Sequence:CCGGGACGGTGATATTGGAAATTATCTCGAGATAATTTCCAATATCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-789s1c1
Sequence:CCGGGACGGTATCATTCCATAAATACTCGAGTATTTATGGAATGATACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001527.1-568s1c1
Sequence:CCGGGCTGTGAAGTTAAACCGACAACTCGAGTTGTCGGTTTAACTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)