EMAIL THIS PAGE TO A FRIEND

HDAC3

histone deacetylase 3

90 Gene Product Result for
Synonyms: HD3 RPD3 RPD3-2
UniProtKB ID: O15379, D3DQE1, O43268, Q9UEI5, Q9UEV0
Gene ID:
Human(8841) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(15183) histone deacetylase 3
Rat(84578) histone deacetylase 3
sheep(101107092) histone deacetylase 3
domestic guinea pig(100718985) histone deacetylase 3
naked mole-rat(101708680) histone deacetylase 3
Zebrafish(393965) histone deacetylase 3
cow(404125) histone deacetylase 3
domestic cat(101100941) histone deacetylase 3
dog(478040) histone deacetylase 3
chicken(395506) histone deacetylase 3
fruit fly(44446) Histone deacetylase 3
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702037 Anti-HDAC3 (C-terminal) antibody produced in rabbit human, mouse
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2701673 Anti-hdac3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA052052 Anti-HDAC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503481 Anti-HDAC3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503482 Anti-HDAC3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106601 Anti-HDAC3 antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, rabbit, horse
western blot pricing
SAB1411573 Anti-HDAC3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
H3034 Anti-Histone Deacetylase 3 (HDAC3) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4504189 Anti-phospho-HDAC3 (pSer424) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301541 Anti-phospho-HDAC3 (pSer424) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
WH0008841M2 Monoclonal Anti-HDAC3 antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1409952 Monoclonal Anti-HDAC3 antibody produced in mouse clone 2F9-4B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP) pricing
SAB1404635 Monoclonal Anti-HDAC3, (C-terminal) antibody produced in mouse clone 2A3, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
H6537 Monoclonal Anti-Histone Deacetylase 3 (HDAC3) antibody produced in mouse ~1 mg/mL, clone HDAC3-83, purified immunoglobulin, buffered aqueous solution human, mouse
microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003883 Rosetta Predictions human pricing
NM_053448 Rosetta Predictions rat pricing
NM_010411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136351 predicted 849
2 SASI_Hs01_00136352 predicted 1062
3 SASI_Hs01_00136353 predicted 739
4 SASI_Hs01_00136354 predicted 341
5 SASI_Hs01_00136355 predicted 1230
6 SASI_Hs01_00136356 predicted 590
7 SASI_Hs01_00136357 predicted 1037
8 SASI_Hs01_00136358 predicted 1036
9 SASI_Hs02_00336492 predicted 1301
10 SASI_Hs02_00336493 predicted 442
11 SASI_Hs01_00136350 predicted 419
12 SASI_Hs01_00136359 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031908 predicted 346
2 SASI_Rn01_00031909 predicted 499
3 SASI_Rn01_00031910 predicted 1088
4 SASI_Rn01_00031911 predicted 282
5 SASI_Rn01_00031912 predicted 291
6 SASI_Rn01_00031913 predicted 210
7 SASI_Rn01_00031914 predicted 1268
8 SASI_Rn01_00031915 predicted 1188
9 SASI_Rn01_00031916 predicted 1520
10 SASI_Rn01_00031917 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318546 predicted 529
2 SASI_Mm01_00162230 predicted 735
3 SASI_Mm01_00162231 predicted 331
4 SASI_Mm01_00162232 predicted 316
5 SASI_Mm01_00162233 predicted 236
6 SASI_Mm01_00162234 predicted 861
7 SASI_Mm01_00162235 predicted 501
8 SASI_Mm01_00162236 predicted 1043
9 SASI_Mm01_00162237 predicted 712
10 SASI_Mm01_00162238 predicted 930
11 SASI_Mm01_00162239 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010411
VALIDATED
HDAC3 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-1145s1c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-398s1c1
Sequence:CCGGGAGGCCATTAGTGAGGAACTTCTCGAGAAGTTCCTCACTAATGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-285s1c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-130s1c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-183s21c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010411.2-911s21c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010411.2-1774s21c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-1309s21c1
Sequence:CCGGGAGTTCTATGATGGCGACCATCTCGAGATGGTCGCCATCATAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010411
VALIDATED
HDAC3 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-1145s1c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-398s1c1
Sequence:CCGGGAGGCCATTAGTGAGGAACTTCTCGAGAAGTTCCTCACTAATGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-285s1c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-130s1c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-183s21c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010411.2-911s21c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010411.2-1774s21c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-1309s21c1
Sequence:CCGGGAGTTCTATGATGGCGACCATCTCGAGATGGTCGCCATCATAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010411
VALIDATED
HDAC3 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-1145s1c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-398s1c1
Sequence:CCGGGAGGCCATTAGTGAGGAACTTCTCGAGAAGTTCCTCACTAATGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-285s1c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010411.1-130s1c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-183s21c1
Sequence:CCGGCCTGCATTATGGTCTCTATAACTCGAGTTATAGAGACCATAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010411.2-911s21c1
Sequence:CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010411.2-1774s21c1
Sequence:CCGGCGTGGCTCTCTGAAACCTTAACTCGAGTTAAGGTTTCAGAGAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010411.2-1309s21c1
Sequence:CCGGGAGTTCTATGATGGCGACCATCTCGAGATGGTCGCCATCATAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003883
VALIDATED
HDAC3 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-627s1c1
Sequence:CCGGCCTTCCACAAATACGGAAATTCTCGAGAATTTCCGTATTTGTGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-1169s1c1
Sequence:CCGGGCACCTAGTGTCCAGATTCATCTCGAGATGAATCTGGACACTAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-172s1c1
Sequence:CCGGCGGTCTCTATAAGAAGATGATCTCGAGATCATCTTCTTATAGAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-355s1c1
Sequence:CCGGCTTTGAGTTCTGCTCGCGTTACTCGAGTAACGCGAGCAGAACTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-418s1c1
Sequence:CCGGGATCTGTGATATTGCCATTAACTCGAGTTAATGGCAATATCACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1058s1c1
Sequence:CCGGGACTTCACACTTCATCCAGATCTCGAGATCTGGATGAAGTGTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-301s1c1
Sequence:CCGGCAAGAGTCTTAATGCCTTCAACTCGAGTTGAAGGCATTAAGACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-163s1c1
Sequence:CCGGCCTGCATTACGGTCTCTATAACTCGAGTTATAGAGACCGTAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-478s1c1
Sequence:CCGGCTCTGGCTTCTGCTATGTCAACTCGAGTTGACATAGCAGAAGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1565s1c1
Sequence:CCGGGATAGCTATCTGGGACATTATCTCGAGATAATGTCCCAGATAGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1524s1c1
Sequence:CCGGGCCTGACAATGGTACCTATTACTCGAGTAATAGGTACCATTGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1088s1c1
Sequence:CCGGCGCATCGAGAATCAGAACTCACTCGAGTGAGTTCTGATTCTCGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003883
VALIDATED
HDAC3 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-627s1c1
Sequence:CCGGCCTTCCACAAATACGGAAATTCTCGAGAATTTCCGTATTTGTGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-1169s1c1
Sequence:CCGGGCACCTAGTGTCCAGATTCATCTCGAGATGAATCTGGACACTAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-172s1c1
Sequence:CCGGCGGTCTCTATAAGAAGATGATCTCGAGATCATCTTCTTATAGAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-355s1c1
Sequence:CCGGCTTTGAGTTCTGCTCGCGTTACTCGAGTAACGCGAGCAGAACTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-418s1c1
Sequence:CCGGGATCTGTGATATTGCCATTAACTCGAGTTAATGGCAATATCACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1058s1c1
Sequence:CCGGGACTTCACACTTCATCCAGATCTCGAGATCTGGATGAAGTGTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-301s1c1
Sequence:CCGGCAAGAGTCTTAATGCCTTCAACTCGAGTTGAAGGCATTAAGACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-163s1c1
Sequence:CCGGCCTGCATTACGGTCTCTATAACTCGAGTTATAGAGACCGTAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-478s1c1
Sequence:CCGGCTCTGGCTTCTGCTATGTCAACTCGAGTTGACATAGCAGAAGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1565s1c1
Sequence:CCGGGATAGCTATCTGGGACATTATCTCGAGATAATGTCCCAGATAGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1524s1c1
Sequence:CCGGGCCTGACAATGGTACCTATTACTCGAGTAATAGGTACCATTGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1088s1c1
Sequence:CCGGCGCATCGAGAATCAGAACTCACTCGAGTGAGTTCTGATTCTCGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003883
VALIDATED
HDAC3 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-627s1c1
Sequence:CCGGCCTTCCACAAATACGGAAATTCTCGAGAATTTCCGTATTTGTGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-1169s1c1
Sequence:CCGGGCACCTAGTGTCCAGATTCATCTCGAGATGAATCTGGACACTAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-172s1c1
Sequence:CCGGCGGTCTCTATAAGAAGATGATCTCGAGATCATCTTCTTATAGAGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-355s1c1
Sequence:CCGGCTTTGAGTTCTGCTCGCGTTACTCGAGTAACGCGAGCAGAACTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-418s1c1
Sequence:CCGGGATCTGTGATATTGCCATTAACTCGAGTTAATGGCAATATCACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1058s1c1
Sequence:CCGGGACTTCACACTTCATCCAGATCTCGAGATCTGGATGAAGTGTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003883.2-301s1c1
Sequence:CCGGCAAGAGTCTTAATGCCTTCAACTCGAGTTGAAGGCATTAAGACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003883.2-163s1c1
Sequence:CCGGCCTGCATTACGGTCTCTATAACTCGAGTTATAGAGACCGTAATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-478s1c1
Sequence:CCGGCTCTGGCTTCTGCTATGTCAACTCGAGTTGACATAGCAGAAGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1565s1c1
Sequence:CCGGGATAGCTATCTGGGACATTATCTCGAGATAATGTCCCAGATAGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003883.2-1524s1c1
Sequence:CCGGGCCTGACAATGGTACCTATTACTCGAGTAATAGGTACCATTGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003883.2-1088s1c1
Sequence:CCGGCGCATCGAGAATCAGAACTCACTCGAGTGAGTTCTGATTCTCGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)