EMAIL THIS PAGE TO A FRIEND

HDAC4

histone deacetylase 4

221 Gene Product Result for
Synonyms: AHO3 BDMR HA6116 HD4 HDAC-4 HDAC-A HDACA
UniProtKB ID: P56524, Q9UND6
Gene ID:
Human(9759) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
Mouse(208727) histone deacetylase 4
Rat(363287) histone deacetylase 4
Zebrafish(568877) histone deacetylase 4
chicken(374207) histone deacetylase 4
dog(607662) histone deacetylase 4
cow(517559) histone deacetylase 4
domestic cat(101093384) histone deacetylase 4
fruit fly(32278) CG1770 gene product from transcript CG1770-RG
domestic guinea pig(100713301) histone deacetylase 4
naked mole-rat(101696612) histone deacetylase 4
sheep(101108012) histone deacetylase 4
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300413 Anti-HDAC4 (Ab-632) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB2101022 Anti-HDAC4 (ab1) antibody produced in rabbit affinity isolated antibody mouse, rat, horse, zebrafish, human, guinea pig
western blot pricing
SAB2101023 Anti-HDAC4 (ab2) antibody produced in rabbit affinity isolated antibody human, mouse, rat, rabbit, guinea pig
western blot pricing
SAB4503697 Anti-HDAC4 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
HPA048723 Anti-HDAC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4300584 Anti-HDAC9/HDAC4/HDAC5 (Ab-246/259/220) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
H9536 Anti-Histone Deacetylase 4 (HDAC4) (DM-15) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
H9411 Anti-Histone Deacetylase 4 (HDAC4) (ML-19) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
SAB4300155 Anti-phospho-HDAC4 (pSer632) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504422 Anti-phospho-HDAC4 (pSer632) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300269 Anti-phospho-HDAC9/HDAC4/HDAC5 (pSer246/pSer259/pSer220) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB5300452 Monoclonal Anti-HDAC4 antibody produced in mouse clone 7B2, ascites fluid human
ELISA, western blot pricing
SAB1402484 Monoclonal Anti-HDAC4 antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H0163 Monoclonal Anti-Histone Deacetylase 4 (HDAC4) antibody produced in mouse ~2 mg/mL, clone HDAC4-144, purified immunoglobulin, buffered aqueous solution mouse, human, rat
immunocytochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T8552 Trichostatin A ≥98% (HPLC), from Streptomyces sp. human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136981 MISSION® esiRNA esiRNA human HDAC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006037 Rosetta Predictions human pricing
XM_001067733 Rosetta Predictions rat pricing
XM_343629 Rosetta Predictions rat pricing
NM_207225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340778 predicted 3251
2 SASI_Hs01_00072640 predicted 4099
3 SASI_Hs02_00340779 predicted 1630
4 SASI_Hs01_00072642 predicted 1768
5 SASI_Hs01_00072643 predicted 3498
6 SASI_Hs01_00072644 predicted 1537
7 SASI_Hs01_00072645 predicted 3804
8 SASI_Hs02_00340780 predicted 2781
9 SASI_Hs02_00340781 predicted 4168
10 SASI_Hs02_00340782 predicted 1775
11 SASI_Hs01_00072641 predicted 1521
12 SASI_Hs01_00072646 predicted 3505
13 SASI_Hs01_00072647 predicted 1497
14 SASI_Hs01_00072648 predicted 1489
15 SASI_Hs01_00072649 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322007 predicted 296
2 SASI_Rn02_00322008 predicted 2532
3 SASI_Rn02_00322009 predicted 2296
4 SASI_Rn02_00322010 predicted 2790
5 SASI_Rn02_00322011 predicted 1074
6 SASI_Rn02_00322012 predicted 2138
7 SASI_Rn02_00322013 predicted 3427
8 SASI_Rn02_00322014 predicted 1184
9 SASI_Rn02_00322015 predicted 2487
10 SASI_Rn02_00322016 predicted 2746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396118 predicted 554
2 SASI_Rn02_00396119 predicted 329
3 SASI_Rn02_00396120 predicted 544
4 SASI_Rn02_00396121 predicted 574
5 SASI_Rn02_00396122 predicted 333
6 SASI_Rn02_00396123 predicted 536
7 SASI_Rn02_00396124 predicted 539
8 SASI_Rn02_00396125 predicted 465
9 SASI_Rn02_00396126 predicted 579
10 SASI_Rn02_00396127 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195677 predicted 420
2 SASI_Mm01_00195678 predicted 856
3 SASI_Mm01_00195679 predicted 2602
4 SASI_Mm01_00195680 predicted 2824
5 SASI_Mm01_00195681 predicted 1164
6 SASI_Mm01_00195682 predicted 2798
7 SASI_Mm01_00195683 predicted 1917
8 SASI_Mm01_00195684 predicted 2277
9 SASI_Mm01_00195685 predicted 2975
10 SASI_Mm01_00195686 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006037
VALIDATED
HDAC4 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2984s21c1
Sequence:GTACCGGAGAAACTGGACAGTAAGAAACCTCGAGGTTTCTTACTGTCCAGTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2030s21c1
Sequence:GTACCGGTTCTGCAGCACATGGTCTTACCTCGAGGTAAGACCATGTGCTGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1318s21c1
Sequence:CCGGCAAGAATTTGTCCTCAATAAACTCGAGTTTATTGAGGACAAATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1449s21c1
Sequence:CCGGCGGAGTGTCGACCTCCTATAACTCGAGTTATAGGAGGTCGACACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1359s21c1
Sequence:CCGGGAATCTGAACCACTGCATTTCCTCGAGGAAATGCAGTGGTTCAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1495s21c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006037.2-3818s1c1
Sequence:CCGGCCAATGCAAACGCTGTCCGTTCTCGAGAACGGACAGCGTTTGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-1495s1c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-4508s1c1
Sequence:CCGGCGACTCATCTTGTAGCTTATTCTCGAGAATAAGCTACAAGATGAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006037.2-1314s1c1
Sequence:CCGGGTTACAAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTTGTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006037
VALIDATED
HDAC4 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2984s21c1
Sequence:GTACCGGAGAAACTGGACAGTAAGAAACCTCGAGGTTTCTTACTGTCCAGTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2030s21c1
Sequence:GTACCGGTTCTGCAGCACATGGTCTTACCTCGAGGTAAGACCATGTGCTGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1318s21c1
Sequence:CCGGCAAGAATTTGTCCTCAATAAACTCGAGTTTATTGAGGACAAATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1449s21c1
Sequence:CCGGCGGAGTGTCGACCTCCTATAACTCGAGTTATAGGAGGTCGACACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1359s21c1
Sequence:CCGGGAATCTGAACCACTGCATTTCCTCGAGGAAATGCAGTGGTTCAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1495s21c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006037.2-3818s1c1
Sequence:CCGGCCAATGCAAACGCTGTCCGTTCTCGAGAACGGACAGCGTTTGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-1495s1c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-4508s1c1
Sequence:CCGGCGACTCATCTTGTAGCTTATTCTCGAGAATAAGCTACAAGATGAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006037.2-1314s1c1
Sequence:CCGGGTTACAAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTTGTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006037
VALIDATED
HDAC4 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2984s21c1
Sequence:GTACCGGAGAAACTGGACAGTAAGAAACCTCGAGGTTTCTTACTGTCCAGTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006037.3-2030s21c1
Sequence:GTACCGGTTCTGCAGCACATGGTCTTACCTCGAGGTAAGACCATGTGCTGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1318s21c1
Sequence:CCGGCAAGAATTTGTCCTCAATAAACTCGAGTTTATTGAGGACAAATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1449s21c1
Sequence:CCGGCGGAGTGTCGACCTCCTATAACTCGAGTTATAGGAGGTCGACACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1359s21c1
Sequence:CCGGGAATCTGAACCACTGCATTTCCTCGAGGAAATGCAGTGGTTCAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006037.3-1495s21c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006037.2-3818s1c1
Sequence:CCGGCCAATGCAAACGCTGTCCGTTCTCGAGAACGGACAGCGTTTGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-1495s1c1
Sequence:CCGGGCCAAAGATGACTTCCCTCTTCTCGAGAAGAGGGAAGTCATCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006037.2-4508s1c1
Sequence:CCGGCGACTCATCTTGTAGCTTATTCTCGAGAATAAGCTACAAGATGAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006037.2-1314s1c1
Sequence:CCGGGTTACAAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTTGTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207225
HDAC4 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000039250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-2519s1c1
Sequence:CCGGCATGGGTTTCTGCTACTTTAACTCGAGTTAAAGTAGCAGAAACCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3211s1c1
Sequence:CCGGACTCTCTGATTGAGGCGCAAACTCGAGTTTGCGCCTCAATCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-426s1c1
Sequence:CCGGGAGGCACAGTTGCATGAACATCTCGAGATGTTCATGCAACTGTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3102s1c1
Sequence:CCGGGTTCTACATCAGAGACCCAATCTCGAGATTGGGTCTCTGATGTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207225
HDAC4 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000039250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-2519s1c1
Sequence:CCGGCATGGGTTTCTGCTACTTTAACTCGAGTTAAAGTAGCAGAAACCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3211s1c1
Sequence:CCGGACTCTCTGATTGAGGCGCAAACTCGAGTTTGCGCCTCAATCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-426s1c1
Sequence:CCGGGAGGCACAGTTGCATGAACATCTCGAGATGTTCATGCAACTGTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3102s1c1
Sequence:CCGGGTTCTACATCAGAGACCCAATCTCGAGATTGGGTCTCTGATGTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207225
HDAC4 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000039250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-2519s1c1
Sequence:CCGGCATGGGTTTCTGCTACTTTAACTCGAGTTAAAGTAGCAGAAACCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3211s1c1
Sequence:CCGGACTCTCTGATTGAGGCGCAAACTCGAGTTTGCGCCTCAATCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-426s1c1
Sequence:CCGGGAGGCACAGTTGCATGAACATCTCGAGATGTTCATGCAACTGTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207225.1-3102s1c1
Sequence:CCGGGTTCTACATCAGAGACCCAATCTCGAGATTGGGTCTCTGATGTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)