EMAIL THIS PAGE TO A FRIEND

HDAC5

histone deacetylase 5

117 Gene Product Result for
Synonyms: HD5 NY-CO-9
UniProtKB ID: Q9UQL6, C9JFV9, O60340, O60528, Q96DY4
Gene ID:
Human(10014) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15184) histone deacetylase 5
Rat(84580) histone deacetylase 5
sheep(101113686) histone deacetylase 5
domestic guinea pig(100722799) histone deacetylase 5
naked mole-rat(101721186) histone deacetylase 5
cow(504242) histone deacetylase 5
domestic cat(101098019) histone deacetylase 5
dog(490941) histone deacetylase 5
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300414 Anti-HDAC5 (Ab-498) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4500020 Anti-HDAC5 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500021 Anti-HDAC5 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500022 Anti-HDAC5 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA030991 Anti-HDAC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4300584 Anti-HDAC9/HDAC4/HDAC5 (Ab-246/259/220) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
H8163 Anti-Histone Deacetylase 5 (HDAC5) (NA-16) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
H4538 Anti-Histone Deacetylase 5 (HDAC5) antibody, Mouse monoclonal clone HDAC5-35, purified from hybridoma cell culture mouse, rat, human
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4503878 Anti-phospho-HDAC5 (pSer259) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300156 Anti-phospho-HDAC5 (pSer498) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4504423 Anti-phospho-HDAC5 (pSer498) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300269 Anti-phospho-HDAC9/HDAC4/HDAC5 (pSer246/pSer259/pSer220) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0010014M1 Monoclonal Anti-HDAC5 antibody produced in mouse clone 4G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015053 Rosetta Predictions human pricing
NM_005474 Rosetta Predictions human pricing
XM_001081495 Rosetta Predictions rat pricing
XM_213469 Rosetta Predictions rat pricing
NM_001077696 Rosetta Predictions mouse pricing
NM_010412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028155 predicted 1187
2 SASI_Hs01_00028156 predicted 1193
3 SASI_Hs01_00028157 predicted 1114
4 SASI_Hs01_00028158 predicted 3281
5 SASI_Hs01_00028159 predicted 3010
6 SASI_Hs01_00028161 predicted 2396
7 SASI_Hs01_00028162 predicted 2790
8 SASI_Hs01_00028163 predicted 2565
9 SASI_Hs01_00028164 predicted 2540
10 SASI_Hs02_00306642 predicted 2870
11 SASI_Hs01_00028160 predicted 3500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121126 predicted 1184
2 SASI_Hs01_00121127 predicted 1191
3 SASI_Hs01_00121128 predicted 1117
4 SASI_Hs01_00121129 predicted 3282
5 SASI_Hs01_00121130 predicted 3007
6 SASI_Hs01_00121132 predicted 2397
7 SASI_Hs01_00121133 predicted 2786
8 SASI_Hs01_00121134 predicted 2565
9 SASI_Hs01_00121135 predicted 2539
10 SASI_Hs02_00339651 predicted 2863
11 SASI_Hs01_00121131 predicted 3495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372147 predicted 2407
2 SASI_Rn02_00372148 predicted 1395
3 SASI_Rn02_00372149 predicted 3448
4 SASI_Rn02_00372150 predicted 1174
5 SASI_Rn02_00372151 predicted 3176
6 SASI_Rn02_00372152 predicted 1057
7 SASI_Rn02_00372153 predicted 2519
8 SASI_Rn02_00372154 predicted 1044
9 SASI_Rn02_00372155 predicted 3195
10 SASI_Rn02_00372156 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170190 predicted 1506
2 SASI_Rn01_00170191 predicted 492
3 SASI_Rn01_00170192 predicted 2534
4 SASI_Rn01_00170193 predicted 274
5 SASI_Rn01_00170194 predicted 2273
6 SASI_Rn01_00170195 predicted 1618
7 SASI_Rn01_00170196 predicted 1974
8 SASI_Rn01_00170197 predicted 2290
9 SASI_Rn01_00170198 predicted 1880
10 SASI_Rn01_00170199 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292902 predicted 2702
2 SASI_Mm02_00292903 predicted 3211
3 SASI_Mm02_00292904 predicted 2730
4 SASI_Mm02_00292905 predicted 3196
5 SASI_Mm02_00292906 predicted 3489
6 SASI_Mm02_00292907 predicted 2801
7 SASI_Mm02_00292908 predicted 1412
8 SASI_Mm02_00292909 predicted 1778
9 SASI_Mm02_00292910 predicted 2661
10 SASI_Mm02_00292911 predicted 3037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318547 predicted 2702
2 SASI_Mm01_00032433 predicted 3210
3 SASI_Mm01_00032434 predicted 2731
4 SASI_Mm01_00032435 predicted 3195
5 SASI_Mm01_00032436 predicted 3492
6 SASI_Mm01_00032437 predicted 2798
7 SASI_Mm01_00032438 predicted 1415
8 SASI_Mm01_00032439 predicted 1776
9 SASI_Mm01_00032441 predicted 2658
10 SASI_Mm02_00318548 predicted 3031
11 SASI_Mm01_00032440 predicted 1415
12 SASI_Mm01_00032442 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010412
VALIDATED
HDAC5 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-1645s1c1
Sequence:CCGGCTGGGCAAGATCCTTACCAAACTCGAGTTTGGTAAGGATCTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2136s1c1
Sequence:CCGGGCACCAGTGTATGTGCGGAAACTCGAGTTTCCGCACATACACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-618s1c1
Sequence:CCGGCCAGGAATTCCTGTTGTCCAACTCGAGTTGGACAACAGGAATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2514s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCTATCTCGAGATAGCAAATCCATTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010412.2-1129s1c1
Sequence:CCGGCCAAACCAGTTCAGCCTCTATCTCGAGATAGAGGCTGAACTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010412.3-1112s21c1
Sequence:CCGGGGCCTCGGAACCCAACTTAAACTCGAGTTTAAGTTGGGTTCCGAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2884s21c1
Sequence:CCGGCCGTAGCCATCACAGCTAAACCTCGAGGTTTAGCTGTGATGGCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1040s21c1
Sequence:CCGGGACGCCTCCCTCCTACAAATTCTCGAGAATTTGTAGGAGGGAGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2938s21c1
Sequence:CCGGTCATCGTGGACTGGGATATTCCTCGAGGAATATCCCAGTCCACGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1325s21c1
Sequence:CCGGCATCGCTGAGAACGGCTTTACCTCGAGGTAAAGCCGTTCTCAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010412
VALIDATED
HDAC5 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-1645s1c1
Sequence:CCGGCTGGGCAAGATCCTTACCAAACTCGAGTTTGGTAAGGATCTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2136s1c1
Sequence:CCGGGCACCAGTGTATGTGCGGAAACTCGAGTTTCCGCACATACACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-618s1c1
Sequence:CCGGCCAGGAATTCCTGTTGTCCAACTCGAGTTGGACAACAGGAATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2514s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCTATCTCGAGATAGCAAATCCATTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010412.2-1129s1c1
Sequence:CCGGCCAAACCAGTTCAGCCTCTATCTCGAGATAGAGGCTGAACTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010412.3-1112s21c1
Sequence:CCGGGGCCTCGGAACCCAACTTAAACTCGAGTTTAAGTTGGGTTCCGAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2884s21c1
Sequence:CCGGCCGTAGCCATCACAGCTAAACCTCGAGGTTTAGCTGTGATGGCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1040s21c1
Sequence:CCGGGACGCCTCCCTCCTACAAATTCTCGAGAATTTGTAGGAGGGAGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2938s21c1
Sequence:CCGGTCATCGTGGACTGGGATATTCCTCGAGGAATATCCCAGTCCACGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1325s21c1
Sequence:CCGGCATCGCTGAGAACGGCTTTACCTCGAGGTAAAGCCGTTCTCAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010412
VALIDATED
HDAC5 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-1645s1c1
Sequence:CCGGCTGGGCAAGATCCTTACCAAACTCGAGTTTGGTAAGGATCTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2136s1c1
Sequence:CCGGGCACCAGTGTATGTGCGGAAACTCGAGTTTCCGCACATACACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-618s1c1
Sequence:CCGGCCAGGAATTCCTGTTGTCCAACTCGAGTTGGACAACAGGAATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010412.2-2514s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCTATCTCGAGATAGCAAATCCATTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010412.2-1129s1c1
Sequence:CCGGCCAAACCAGTTCAGCCTCTATCTCGAGATAGAGGCTGAACTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010412.3-1112s21c1
Sequence:CCGGGGCCTCGGAACCCAACTTAAACTCGAGTTTAAGTTGGGTTCCGAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2884s21c1
Sequence:CCGGCCGTAGCCATCACAGCTAAACCTCGAGGTTTAGCTGTGATGGCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1040s21c1
Sequence:CCGGGACGCCTCCCTCCTACAAATTCTCGAGAATTTGTAGGAGGGAGGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-2938s21c1
Sequence:CCGGTCATCGTGGACTGGGATATTCCTCGAGGAATATCCCAGTCCACGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010412.3-1325s21c1
Sequence:CCGGCATCGCTGAGAACGGCTTTACCTCGAGGTAAAGCCGTTCTCAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005474
VALIDATED
HDAC5 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005474.3-1165s1c1
Sequence:CCGGGACTGTTATTAGCACCTTTAACTCGAGTTAAAGGTGCTAATAACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-2761s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCCATCTCGAGATGGCAAATCCATTCTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-3442s1c1
Sequence:CCGGGCTAGAGAAAGTCATCGAGATCTCGAGATCTCGATGACTTTCTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-2501s1c1
Sequence:CCGGGCTTAGCAAGTGCGAGCGGATCTCGAGATCCGCTCGCACTTGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-1315s1c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-605s1c1
Sequence:CCGGGCAGCTCCTGTTCGCTGAGTTCTCGAGAACTCAGCGAACAGGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-3177s1c1
Sequence:CCGGGCCCACGAGTTCTCACCTGATCTCGAGATCAGGTGAGAACTCGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-368s21c1
Sequence:CCGGTCGGGAACCATCCTTGGAAATCTCGAGATTTCCAAGGATGGTTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005474.4-4145s21c1
Sequence:CCGGGAGGATCCACTACTGTCTTTACTCGAGTAAAGACAGTAGTGGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1184s21c1
Sequence:CCGGCAAGGATGGGACTGTTATTAGCTCGAGCTAATAACAGTCCCATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1315s21c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-2390s21c1
Sequence:CCGGCTACGACACGTTCATGCTAAACTCGAGTTTAGCATGAACGTGTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005474
VALIDATED
HDAC5 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005474.3-1165s1c1
Sequence:CCGGGACTGTTATTAGCACCTTTAACTCGAGTTAAAGGTGCTAATAACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-2761s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCCATCTCGAGATGGCAAATCCATTCTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-3442s1c1
Sequence:CCGGGCTAGAGAAAGTCATCGAGATCTCGAGATCTCGATGACTTTCTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-2501s1c1
Sequence:CCGGGCTTAGCAAGTGCGAGCGGATCTCGAGATCCGCTCGCACTTGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-1315s1c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-605s1c1
Sequence:CCGGGCAGCTCCTGTTCGCTGAGTTCTCGAGAACTCAGCGAACAGGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-3177s1c1
Sequence:CCGGGCCCACGAGTTCTCACCTGATCTCGAGATCAGGTGAGAACTCGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-368s21c1
Sequence:CCGGTCGGGAACCATCCTTGGAAATCTCGAGATTTCCAAGGATGGTTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005474.4-4145s21c1
Sequence:CCGGGAGGATCCACTACTGTCTTTACTCGAGTAAAGACAGTAGTGGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1184s21c1
Sequence:CCGGCAAGGATGGGACTGTTATTAGCTCGAGCTAATAACAGTCCCATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1315s21c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-2390s21c1
Sequence:CCGGCTACGACACGTTCATGCTAAACTCGAGTTTAGCATGAACGTGTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005474
VALIDATED
HDAC5 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005474.3-1165s1c1
Sequence:CCGGGACTGTTATTAGCACCTTTAACTCGAGTTAAAGGTGCTAATAACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-2761s1c1
Sequence:CCGGGCTCAAGAATGGATTTGCCATCTCGAGATGGCAAATCCATTCTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005474.3-3442s1c1
Sequence:CCGGGCTAGAGAAAGTCATCGAGATCTCGAGATCTCGATGACTTTCTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-2501s1c1
Sequence:CCGGGCTTAGCAAGTGCGAGCGGATCTCGAGATCCGCTCGCACTTGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-1315s1c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-605s1c1
Sequence:CCGGGCAGCTCCTGTTCGCTGAGTTCTCGAGAACTCAGCGAACAGGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005474.4-3177s1c1
Sequence:CCGGGCCCACGAGTTCTCACCTGATCTCGAGATCAGGTGAGAACTCGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-368s21c1
Sequence:CCGGTCGGGAACCATCCTTGGAAATCTCGAGATTTCCAAGGATGGTTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005474.4-4145s21c1
Sequence:CCGGGAGGATCCACTACTGTCTTTACTCGAGTAAAGACAGTAGTGGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1184s21c1
Sequence:CCGGCAAGGATGGGACTGTTATTAGCTCGAGCTAATAACAGTCCCATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-1315s21c1
Sequence:CCGGCCATCGCTGAGAATGGCTTTACTCGAGTAAAGCCATTCTCAGCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005474.4-2390s21c1
Sequence:CCGGCTACGACACGTTCATGCTAAACTCGAGTTTAGCATGAACGTGTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)