EMAIL THIS PAGE TO A FRIEND

HDAC6

histone deacetylase 6

109 Gene Product Result for
Synonyms: HD6
UniProtKB ID: Q9UBN7, O94975, Q6NT75, Q7L3E5, Q96CY0
Gene ID:
Human(10013) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It contains an internal duplication of two catalytic domains which appear to function independently of each other. This protein possesses histone deacetylase activity and represses transcription. [provided by RefSeq, Jul 2008]
Mouse(15185) histone deacetylase 6
Rat(84581) histone deacetylase 6
Zebrafish(565482) histone deacetylase 6
domestic cat(101084086) histone deacetylase 6
cow(513602) histone deacetylase 6
dog(480907) histone deacetylase 6
fruit fly(32461) CG6170 gene product from transcript CG6170-RA
domestic guinea pig(100717988) histone deacetylase 6
naked mole-rat(101708442) histone deacetylase 6
sheep(101109245) histone deacetylase 6
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406911 Anti-HDAC6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV31451 Anti-HDAC6 antibody produced in rabbit affinity isolated antibody canine, human, horse, pig, rat, bovine, mouse, guinea pig, rabbit
immunohistochemistry, western blot pricing
HPA026321 Anti-HDAC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA003714 Anti-HDAC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry pricing
SAB2106255 Anti-HDAC6 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig
ELISA, western blot pricing
SAB4500012 Anti-HDAC6, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500011 Anti-HDAC6, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H2287 Anti-Histone Deacetylase 6 (HDAC6) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunoprecipitation (IP), microarray, western blot pricing
SAB4504190 Anti-phospho-HDAC6 (pSer22) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301481 Anti-phospho-HDAC6 (pSer22) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0010013M1 Monoclonal Anti-HDAC6 antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404771 Monoclonal Anti-HDAC6 antibody produced in mouse clone 3A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4100346 Monoclonal Anti-HDAC6 antibody produced in mouse clone HDAC6-A149, culture supernatant human
western blot pricing
SAB4100347 Monoclonal Anti-HDAC6 antibody produced in mouse clone HDAC6-B149, culture supernatant human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T8552 Trichostatin A ≥98% (HPLC), from Streptomyces sp. human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006044 Rosetta Predictions human pricing
XM_001057931 Rosetta Predictions rat pricing
XM_228753 Rosetta Predictions rat pricing
NM_001130416 Rosetta Predictions mouse pricing
NM_010413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048982 predicted 3383
2 SASI_Hs02_00340796 predicted 3349
3 SASI_Hs01_00048983 predicted 2558
4 SASI_Hs01_00048984 predicted 2403
5 SASI_Hs01_00048985 predicted 548
6 SASI_Hs01_00048986 predicted 2569
7 SASI_Hs02_00340797 predicted 2858
8 SASI_Hs01_00048987 predicted 365
9 SASI_Hs01_00048988 predicted 3548
10 SASI_Hs01_00048989 predicted 747
11 SASI_Hs01_00048990 predicted 3234
12 SASI_Hs01_00048991 predicted 2729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288013 predicted 593
2 SASI_Rn02_00288014 predicted 2610
3 SASI_Rn02_00288015 predicted 1287
4 SASI_Rn02_00288016 predicted 2159
5 SASI_Rn02_00288017 predicted 2663
6 SASI_Rn02_00288018 predicted 1826
7 SASI_Rn02_00288019 predicted 912
8 SASI_Rn02_00288020 predicted 861
9 SASI_Rn02_00288021 predicted 642
10 SASI_Rn02_00288022 predicted 3329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385447 predicted 595
2 SASI_Rn02_00385448 predicted 2608
3 SASI_Rn02_00385449 predicted 1287
4 SASI_Rn02_00385450 predicted 2157
5 SASI_Rn02_00385451 predicted 2663
6 SASI_Rn02_00385452 predicted 1825
7 SASI_Rn02_00385453 predicted 918
8 SASI_Rn02_00385454 predicted 869
9 SASI_Rn02_00385455 predicted 642
10 SASI_Rn02_00385456 predicted 3327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311178 predicted 718
2 SASI_Mm02_00311179 predicted 2787
3 SASI_Mm02_00311180 predicted 1953
4 SASI_Mm02_00311181 predicted 1036
5 SASI_Mm02_00311182 predicted 3705
6 SASI_Mm02_00311183 predicted 2276
7 SASI_Mm02_00311184 predicted 2933
8 SASI_Mm02_00311185 predicted 1357
9 SASI_Mm02_00311186 predicted 925
10 SASI_Mm02_00311187 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084435 predicted 795
2 SASI_Mm02_00318549 predicted 2865
3 SASI_Mm01_00084436 predicted 2031
4 SASI_Mm01_00084437 predicted 1117
5 SASI_Mm02_00318550 predicted 3785
6 SASI_Mm01_00084438 predicted 2352
7 SASI_Mm01_00084440 predicted 3005
8 SASI_Mm01_00084443 predicted 1432
9 SASI_Mm01_00084444 predicted 994
10 SASI_Mm02_00318551 predicted 1206
11 SASI_Mm01_00084439 predicted 2558
12 SASI_Mm01_00084441 predicted 3208
13 SASI_Mm01_00084442 predicted 2562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006044
VALIDATED
HDAC6 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 6
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2265s21c1
Sequence:GTACCGGTCCCATTGCCTACGAGTTTAACTCGAGTTAAACTCGTAGGCAATGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-828s21c1
Sequence:GTACCGGGAGGGTCCTTATCGTAGATTGCTCGAGCAATCTACGATAAGGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-226s21c1
Sequence:GTACCGGCCCAATCTAGCGGAGGTAAAGCTCGAGCTTTACCTCCGCTAGATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-3385s21c1
Sequence:CCGGCTCACTGATCAGGCCATATTTCTCGAGAAATATGGCCTGATCAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-178s21c1
Sequence:CCGGGTCACTTCGAAGCGAAATATTCTCGAGAATATTTCGCTTCGAAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-2421s21c1
Sequence:CCGGTATCCTAGAGGGTGGCTATAACTCGAGTTATAGCCACCCTCTAGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-3840s21c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2049s21c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-826s1c1
Sequence:CCGGCGGAGGGTCCTTATCGTAGATCTCGAGATCTACGATAAGGACCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-1785s1c1
Sequence:CCGGCAACTTTGACTCCATCTATATCTCGAGATATAGATGGAGTCAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3384s1c1
Sequence:CCGGCCTCACTGATCAGGCCATATTCTCGAGAATATGGCCTGATCAGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2049s1c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-747s1c1
Sequence:CCGGGCACAGTCTTATGGATGGCTACTCGAGTAGCCATCCATAAGACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2272s1c1
Sequence:CCGGGCCTACGAGTTTAACCCAGAACTCGAGTTCTGGGTTAAACTCGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3840s1c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006044
VALIDATED
HDAC6 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 6
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2265s21c1
Sequence:GTACCGGTCCCATTGCCTACGAGTTTAACTCGAGTTAAACTCGTAGGCAATGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-828s21c1
Sequence:GTACCGGGAGGGTCCTTATCGTAGATTGCTCGAGCAATCTACGATAAGGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-226s21c1
Sequence:GTACCGGCCCAATCTAGCGGAGGTAAAGCTCGAGCTTTACCTCCGCTAGATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-3385s21c1
Sequence:CCGGCTCACTGATCAGGCCATATTTCTCGAGAAATATGGCCTGATCAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-178s21c1
Sequence:CCGGGTCACTTCGAAGCGAAATATTCTCGAGAATATTTCGCTTCGAAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-2421s21c1
Sequence:CCGGTATCCTAGAGGGTGGCTATAACTCGAGTTATAGCCACCCTCTAGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-3840s21c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2049s21c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-826s1c1
Sequence:CCGGCGGAGGGTCCTTATCGTAGATCTCGAGATCTACGATAAGGACCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-1785s1c1
Sequence:CCGGCAACTTTGACTCCATCTATATCTCGAGATATAGATGGAGTCAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3384s1c1
Sequence:CCGGCCTCACTGATCAGGCCATATTCTCGAGAATATGGCCTGATCAGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2049s1c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-747s1c1
Sequence:CCGGGCACAGTCTTATGGATGGCTACTCGAGTAGCCATCCATAAGACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2272s1c1
Sequence:CCGGGCCTACGAGTTTAACCCAGAACTCGAGTTCTGGGTTAAACTCGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3840s1c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006044
VALIDATED
HDAC6 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 6
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2265s21c1
Sequence:GTACCGGTCCCATTGCCTACGAGTTTAACTCGAGTTAAACTCGTAGGCAATGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-828s21c1
Sequence:GTACCGGGAGGGTCCTTATCGTAGATTGCTCGAGCAATCTACGATAAGGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-226s21c1
Sequence:GTACCGGCCCAATCTAGCGGAGGTAAAGCTCGAGCTTTACCTCCGCTAGATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-3385s21c1
Sequence:CCGGCTCACTGATCAGGCCATATTTCTCGAGAAATATGGCCTGATCAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-178s21c1
Sequence:CCGGGTCACTTCGAAGCGAAATATTCTCGAGAATATTTCGCTTCGAAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-2421s21c1
Sequence:CCGGTATCCTAGAGGGTGGCTATAACTCGAGTTATAGCCACCCTCTAGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006044.2-3840s21c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006044.2-2049s21c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-826s1c1
Sequence:CCGGCGGAGGGTCCTTATCGTAGATCTCGAGATCTACGATAAGGACCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006044.2-1785s1c1
Sequence:CCGGCAACTTTGACTCCATCTATATCTCGAGATATAGATGGAGTCAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3384s1c1
Sequence:CCGGCCTCACTGATCAGGCCATATTCTCGAGAATATGGCCTGATCAGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2049s1c1
Sequence:CCGGCGGTAATGGAACTCAGCACATCTCGAGATGTGCTGAGTTCCATTACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-747s1c1
Sequence:CCGGGCACAGTCTTATGGATGGCTACTCGAGTAGCCATCCATAAGACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-2272s1c1
Sequence:CCGGGCCTACGAGTTTAACCCAGAACTCGAGTTCTGGGTTAAACTCGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006044.2-3840s1c1
Sequence:CCGGCATCCCATCCTGAATATCCTTCTCGAGAAGGATATTCAGGATGGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010413
VALIDATED
HDAC6 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-2322s21c1
Sequence:CCGGTGAGGATGACCCTAGTGTATTCTCGAGAATACACTAGGGTCATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010413.3-3903s21c1
Sequence:CCGGACCCTTTGCCAGGTGCTTATTCTCGAGAATAAGCACCTGGCAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-1290s21c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010413.2-3573s1c1
Sequence:CCGGGAACCCATCTTGAATACCCTTCTCGAGAAGGGTATTCAAGATGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-681s1c1
Sequence:CCGGGCACAATCTTATGGATGGGTACTCGAGTACCCATCCATAAGATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2283s1c1
Sequence:CCGGCCAAGTAACACCGGAAGGTTACTCGAGTAACCTTCCGGTGTTACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2686s1c1
Sequence:CCGGCCTGGGAAAGAATCTACTCTACTCGAGTAGAGTAGATTCTTTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010413.2-975s1c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010413
VALIDATED
HDAC6 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-2322s21c1
Sequence:CCGGTGAGGATGACCCTAGTGTATTCTCGAGAATACACTAGGGTCATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010413.3-3903s21c1
Sequence:CCGGACCCTTTGCCAGGTGCTTATTCTCGAGAATAAGCACCTGGCAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-1290s21c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010413.2-3573s1c1
Sequence:CCGGGAACCCATCTTGAATACCCTTCTCGAGAAGGGTATTCAAGATGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-681s1c1
Sequence:CCGGGCACAATCTTATGGATGGGTACTCGAGTACCCATCCATAAGATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2283s1c1
Sequence:CCGGCCAAGTAACACCGGAAGGTTACTCGAGTAACCTTCCGGTGTTACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2686s1c1
Sequence:CCGGCCTGGGAAAGAATCTACTCTACTCGAGTAGAGTAGATTCTTTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010413.2-975s1c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010413
VALIDATED
HDAC6 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-2322s21c1
Sequence:CCGGTGAGGATGACCCTAGTGTATTCTCGAGAATACACTAGGGTCATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010413.3-3903s21c1
Sequence:CCGGACCCTTTGCCAGGTGCTTATTCTCGAGAATAAGCACCTGGCAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010413.3-1290s21c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010413.2-3573s1c1
Sequence:CCGGGAACCCATCTTGAATACCCTTCTCGAGAAGGGTATTCAAGATGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-681s1c1
Sequence:CCGGGCACAATCTTATGGATGGGTACTCGAGTACCCATCCATAAGATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2283s1c1
Sequence:CCGGCCAAGTAACACCGGAAGGTTACTCGAGTAACCTTCCGGTGTTACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010413.2-2686s1c1
Sequence:CCGGCCTGGGAAAGAATCTACTCTACTCGAGTAGAGTAGATTCTTTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010413.2-975s1c1
Sequence:CCGGCGCTGACTACATTGCTGCTTTCTCGAGAAAGCAGCAATGTAGTCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)