EMAIL THIS PAGE TO A FRIEND

HDAC7

histone deacetylase 7

148 Gene Product Result for
Synonyms: HD7A HDAC7A
Gene ID:
Human(51564) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56233) histone deacetylase 7
Rat(84582) histone deacetylase 7
sheep(101107515) histone deacetylase 7
domestic guinea pig(100734930) histone deacetylase 7
naked mole-rat(101713063) histone deacetylase 7
chicken(426885) histone deacetylase 7
domestic cat(101087242) histone deacetylase 7
dog(486589) histone deacetylase 7
cow(509843) histone deacetylase 7
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004775 Anti-HDAC7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502143 Anti-HDAC7 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1410941 Anti-HDAC7A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
H2662 Anti-Histone Deacetylase 7 (HDAC7) (KG-17) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
H2537 Anti-Histone Deacetylase 7 (HDAC7) (YS-19) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunoprecipitation (IP), microarray, western blot pricing
SAB4504755 Anti-phospho-HDAC7A (pSer155) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301380 Anti-phospho-HDAC7A (pSer155) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
WH0051564M1 Monoclonal Anti-HDAC7A antibody produced in mouse clone 2B11-1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
H6663 Monoclonal Anti-Histone Deacetylase 7 (HDAC7) antibody produced in mouse clone HDAC7-97, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T8552 Trichostatin A ≥98% (HPLC), from Streptomyces sp. human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078781 MISSION® esiRNA esiRNA human HDAC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098416 Rosetta Predictions human pricing
NM_015401 Rosetta Predictions human pricing
NM_016596 Rosetta Predictions human pricing
XM_001054796 Rosetta Predictions rat pricing
XM_001059057 Rosetta Predictions rat pricing
XM_001059169 Rosetta Predictions rat pricing
XM_345868 Rosetta Predictions rat pricing
NM_019572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318889 predicted 2640
2 SASI_Hs02_00318890 predicted 1188
3 SASI_Hs02_00318891 predicted 3039
4 SASI_Hs02_00318892 predicted 2633
5 SASI_Hs02_00318893 predicted 565
6 SASI_Hs02_00318894 predicted 2518
7 SASI_Hs02_00318895 predicted 3195
8 SASI_Hs02_00318896 predicted 1197
9 SASI_Hs02_00318897 predicted 2166
10 SASI_Hs02_00318898 predicted 2527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239016 predicted 2742
2 SASI_Hs01_00239017 predicted 1303
3 SASI_Hs01_00239018 predicted 3147
4 SASI_Hs01_00239019 predicted 2744
5 SASI_Hs01_00239020 predicted 569
6 SASI_Hs01_00239021 predicted 2634
7 SASI_Hs01_00239022 predicted 3303
8 SASI_Hs01_00239023 predicted 1299
9 SASI_Hs01_00239024 predicted 2279
10 SASI_Hs02_00347769 predicted 2634
11 SASI_Hs01_00239025 predicted 3354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043340 predicted 2531
2 SASI_Hs01_00043341 predicted 1095
3 SASI_Hs01_00043342 predicted 2942
4 SASI_Hs01_00043343 predicted 2536
5 SASI_Hs01_00043344 predicted 481
6 SASI_Hs01_00043345 predicted 2421
7 SASI_Hs01_00043346 predicted 3101
8 SASI_Hs01_00043347 predicted 1095
9 SASI_Hs01_00043348 predicted 2064
10 SASI_Hs01_00043349 predicted 3236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277286 predicted 381
2 SASI_Rn02_00277287 predicted 2402
3 SASI_Rn02_00277288 predicted 2520
4 SASI_Rn02_00277289 predicted 2414
5 SASI_Rn02_00277290 predicted 1230
6 SASI_Rn02_00277291 predicted 2485
7 SASI_Rn02_00277292 predicted 1139
8 SASI_Rn02_00277293 predicted 2533
9 SASI_Rn02_00277294 predicted 697
10 SASI_Rn02_00277295 predicted 2261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291778 predicted 424
2 SASI_Rn02_00291779 predicted 2555
3 SASI_Rn02_00291780 predicted 2682
4 SASI_Rn02_00291781 predicted 2568
5 SASI_Rn02_00291782 predicted 1964
6 SASI_Rn02_00291783 predicted 2636
7 SASI_Rn02_00291784 predicted 2694
8 SASI_Rn02_00291785 predicted 2428
9 SASI_Rn02_00291786 predicted 734
10 SASI_Rn02_00291787 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292218 predicted 379
2 SASI_Rn02_00292219 predicted 2403
3 SASI_Rn02_00292220 predicted 2526
4 SASI_Rn02_00292221 predicted 2409
5 SASI_Rn02_00292222 predicted 1232
6 SASI_Rn02_00292223 predicted 2488
7 SASI_Rn02_00292224 predicted 1133
8 SASI_Rn02_00292225 predicted 2540
9 SASI_Rn02_00292226 predicted 693
10 SASI_Rn02_00292227 predicted 2265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398777 predicted 424
2 SASI_Rn02_00398778 predicted 2554
3 SASI_Rn02_00398779 predicted 2677
4 SASI_Rn02_00398780 predicted 2571
5 SASI_Rn02_00398781 predicted 1963
6 SASI_Rn02_00398782 predicted 2638
7 SASI_Rn02_00398783 predicted 2690
8 SASI_Rn02_00398784 predicted 2429
9 SASI_Rn02_00398785 predicted 732
10 SASI_Rn02_00398786 predicted 2424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133671 predicted 789
2 SASI_Mm01_00133672 predicted 2686
3 SASI_Mm01_00133673 predicted 543
4 SASI_Mm01_00133674 predicted 2563
5 SASI_Mm01_00133675 predicted 2777
6 SASI_Mm01_00133677 predicted 643
7 SASI_Mm01_00133678 predicted 2260
8 SASI_Mm01_00133679 predicted 1302
9 SASI_Mm01_00133680 predicted 2059
10 SASI_Mm02_00324627 predicted 1633
11 SASI_Mm01_00133676 predicted 2577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015401
VALIDATED
HDAC7 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 7
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3466s1c1
Sequence:CCGGTCCACACAGAAATGTGAACTTCTCGAGAAGTTCACATTTCTGTGTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-1778s1c1
Sequence:CCGGGCTGATCTATGACTCGGTCATCTCGAGATGACCGAGTCATAGATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2650s1c1
Sequence:CCGGGCTACCATGTTTCTGCCAAATCTCGAGATTTGGCAGAAACATGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2307s1c1
Sequence:CCGGGCCAGCAAGATCCTCATTGTACTCGAGTACAATGAGGATCTTGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-513s1c1
Sequence:CCGGGCCCTAGAAAGAACAGTCCATCTCGAGATGGACTGTTCTTTCTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-695s1c1
Sequence:CCGGGCTGCGCTATAAGCCCAAGAACTCGAGTTCTTGGGCTTATAGCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3176s1c1
Sequence:CCGGCAAGTAGTTGGAACCAGAGAACTCGAGTTCTCTGGTTCCAACTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015401.1-2095s1c1
Sequence:CCGGCCATCTGGAATGAGCTTCATTCTCGAGAATGAAGCTCATTCCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-2172s1c1
Sequence:CCGGGCTTCTCGTGAGCTAAAGAATCTCGAGATTCTTTAGCTCACGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2183s1c1
Sequence:CCGGGCTAAAGAATGGTTTCGCTGTCTCGAGACAGCGAAACCATTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3417s1c1
Sequence:CCGGCCACTATTCCTGGCTCTGCAACTCGAGTTGCAGAGCCAGGAATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-783s21c1
Sequence:GTACCGGCAACCTGAAGCTGCGCTATAACTCGAGTTATAGCGCAGCTTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-572s21c1
Sequence:CCGGAGAAGCTAGCGGAGGTGATTCCTCGAGGAATCACCTCCGCTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-1308s21c1
Sequence:CCGGCCACTTTGCCCAGTCCTTAATCTCGAGATTAAGGACTGGGCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015401.3-3635s21c1
Sequence:CCGGGGAGCCAAGAGGTCCCATATTCTCGAGAATATGGGACCTCTTGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2973s21c1
Sequence:CCGGGATCCGGGTGCACAGTAAATACTCGAGTATTTACTGTGCACCCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2246s21c1
Sequence:CCGGTCACTGACCTCGCCTTCAAAGCTCGAGCTTTGAAGGCGAGGTCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015401
VALIDATED
HDAC7 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 7
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3466s1c1
Sequence:CCGGTCCACACAGAAATGTGAACTTCTCGAGAAGTTCACATTTCTGTGTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-1778s1c1
Sequence:CCGGGCTGATCTATGACTCGGTCATCTCGAGATGACCGAGTCATAGATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2650s1c1
Sequence:CCGGGCTACCATGTTTCTGCCAAATCTCGAGATTTGGCAGAAACATGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2307s1c1
Sequence:CCGGGCCAGCAAGATCCTCATTGTACTCGAGTACAATGAGGATCTTGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-513s1c1
Sequence:CCGGGCCCTAGAAAGAACAGTCCATCTCGAGATGGACTGTTCTTTCTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-695s1c1
Sequence:CCGGGCTGCGCTATAAGCCCAAGAACTCGAGTTCTTGGGCTTATAGCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3176s1c1
Sequence:CCGGCAAGTAGTTGGAACCAGAGAACTCGAGTTCTCTGGTTCCAACTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015401.1-2095s1c1
Sequence:CCGGCCATCTGGAATGAGCTTCATTCTCGAGAATGAAGCTCATTCCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-2172s1c1
Sequence:CCGGGCTTCTCGTGAGCTAAAGAATCTCGAGATTCTTTAGCTCACGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2183s1c1
Sequence:CCGGGCTAAAGAATGGTTTCGCTGTCTCGAGACAGCGAAACCATTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3417s1c1
Sequence:CCGGCCACTATTCCTGGCTCTGCAACTCGAGTTGCAGAGCCAGGAATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-783s21c1
Sequence:GTACCGGCAACCTGAAGCTGCGCTATAACTCGAGTTATAGCGCAGCTTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-572s21c1
Sequence:CCGGAGAAGCTAGCGGAGGTGATTCCTCGAGGAATCACCTCCGCTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-1308s21c1
Sequence:CCGGCCACTTTGCCCAGTCCTTAATCTCGAGATTAAGGACTGGGCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015401.3-3635s21c1
Sequence:CCGGGGAGCCAAGAGGTCCCATATTCTCGAGAATATGGGACCTCTTGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2973s21c1
Sequence:CCGGGATCCGGGTGCACAGTAAATACTCGAGTATTTACTGTGCACCCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2246s21c1
Sequence:CCGGTCACTGACCTCGCCTTCAAAGCTCGAGCTTTGAAGGCGAGGTCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015401
VALIDATED
HDAC7 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 7
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3466s1c1
Sequence:CCGGTCCACACAGAAATGTGAACTTCTCGAGAAGTTCACATTTCTGTGTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-1778s1c1
Sequence:CCGGGCTGATCTATGACTCGGTCATCTCGAGATGACCGAGTCATAGATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2650s1c1
Sequence:CCGGGCTACCATGTTTCTGCCAAATCTCGAGATTTGGCAGAAACATGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2307s1c1
Sequence:CCGGGCCAGCAAGATCCTCATTGTACTCGAGTACAATGAGGATCTTGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-513s1c1
Sequence:CCGGGCCCTAGAAAGAACAGTCCATCTCGAGATGGACTGTTCTTTCTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-695s1c1
Sequence:CCGGGCTGCGCTATAAGCCCAAGAACTCGAGTTCTTGGGCTTATAGCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3176s1c1
Sequence:CCGGCAAGTAGTTGGAACCAGAGAACTCGAGTTCTCTGGTTCCAACTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015401.1-2095s1c1
Sequence:CCGGCCATCTGGAATGAGCTTCATTCTCGAGAATGAAGCTCATTCCAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-2172s1c1
Sequence:CCGGGCTTCTCGTGAGCTAAAGAATCTCGAGATTCTTTAGCTCACGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015401.1-2183s1c1
Sequence:CCGGGCTAAAGAATGGTTTCGCTGTCTCGAGACAGCGAAACCATTCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015401.1-3417s1c1
Sequence:CCGGCCACTATTCCTGGCTCTGCAACTCGAGTTGCAGAGCCAGGAATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-783s21c1
Sequence:GTACCGGCAACCTGAAGCTGCGCTATAACTCGAGTTATAGCGCAGCTTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-572s21c1
Sequence:CCGGAGAAGCTAGCGGAGGTGATTCCTCGAGGAATCACCTCCGCTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015401.3-1308s21c1
Sequence:CCGGCCACTTTGCCCAGTCCTTAATCTCGAGATTAAGGACTGGGCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015401.3-3635s21c1
Sequence:CCGGGGAGCCAAGAGGTCCCATATTCTCGAGAATATGGGACCTCTTGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2973s21c1
Sequence:CCGGGATCCGGGTGCACAGTAAATACTCGAGTATTTACTGTGCACCCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015401.3-2246s21c1
Sequence:CCGGTCACTGACCTCGCCTTCAAAGCTCGAGCTTTGAAGGCGAGGTCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019572
VALIDATED
HDAC7 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-631s1c1
Sequence:CCGGGCTGAAGTGATCCTGAAGAAACTCGAGTTTCTTCAGGATCACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2694s1c1
Sequence:CCGGCCATGTTTCTGCCAAATGTTTCTCGAGAAACATTTGGCAGAAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2265s1c1
Sequence:CCGGTGCAGATCATTCTACAGCCATCTCGAGATGGCTGTAGAATGATCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019572.2-559s1c1
Sequence:CCGGCTTCGGCAACTTCTCAATAAACTCGAGTTTATTGAGAAGTTGCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-845s1c1
Sequence:CCGGTGCGCTACAAACCCAAGAAATCTCGAGATTTCTTGGGTTTGTAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019572
VALIDATED
HDAC7 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-631s1c1
Sequence:CCGGGCTGAAGTGATCCTGAAGAAACTCGAGTTTCTTCAGGATCACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2694s1c1
Sequence:CCGGCCATGTTTCTGCCAAATGTTTCTCGAGAAACATTTGGCAGAAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2265s1c1
Sequence:CCGGTGCAGATCATTCTACAGCCATCTCGAGATGGCTGTAGAATGATCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019572.2-559s1c1
Sequence:CCGGCTTCGGCAACTTCTCAATAAACTCGAGTTTATTGAGAAGTTGCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-845s1c1
Sequence:CCGGTGCGCTACAAACCCAAGAAATCTCGAGATTTCTTGGGTTTGTAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019572
VALIDATED
HDAC7 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-631s1c1
Sequence:CCGGGCTGAAGTGATCCTGAAGAAACTCGAGTTTCTTCAGGATCACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2694s1c1
Sequence:CCGGCCATGTTTCTGCCAAATGTTTCTCGAGAAACATTTGGCAGAAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-2265s1c1
Sequence:CCGGTGCAGATCATTCTACAGCCATCTCGAGATGGCTGTAGAATGATCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019572.2-559s1c1
Sequence:CCGGCTTCGGCAACTTCTCAATAAACTCGAGTTTATTGAGAAGTTGCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019572.2-845s1c1
Sequence:CCGGTGCGCTACAAACCCAAGAAATCTCGAGATTTCTTGGGTTTGTAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)