EMAIL THIS PAGE TO A FRIEND

HDAC9

histone deacetylase 9

303 Gene Product Result for
Synonyms: HD7 HD7b HD9 HDAC HDAC7 HDAC7B HDAC9B HDAC9FL HDRP MITR
Gene ID:
Human(9734) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
Mouse(79221) histone deacetylase 9
Rat(687001) histone deacetylase 9
sheep(100642178) histone deacetylase 9
domestic guinea pig(100735647) histone deacetylase 9
naked mole-rat(101705971) histone deacetylase 9
chicken(420599) histone deacetylase 9
cow(535415) histone deacetylase 9
domestic cat(101085705) histone deacetylase 9
dog(482339) histone deacetylase 9
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406873 Anti-HDAC9 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108149 Anti-HDAC9 antibody produced in rabbit affinity isolated antibody sheep, guinea pig, rat, bovine, horse, mouse, human, dog
western blot pricing
AV42788 Anti-HDAC9 antibody produced in rabbit IgG fraction of antiserum mouse, sheep, human, guinea pig
ChIP, immunohistochemistry, western blot pricing
SAB2101024 Anti-HDAC9 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, zebrafish, mouse, horse, rabbit, rat, human, chicken
western blot pricing
HPA028926 Anti-HDAC9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4503694 Anti-HDAC9 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300584 Anti-HDAC9/HDAC4/HDAC5 (Ab-246/259/220) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300269 Anti-phospho-HDAC9/HDAC4/HDAC5 (pSer246/pSer259/pSer220) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0009734M1 Monoclonal Anti-HDAC9 antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014707 Rosetta Predictions human pricing
NM_058176 Rosetta Predictions human pricing
NM_058177 Rosetta Predictions human pricing
NM_178423 Rosetta Predictions human pricing
NM_178425 Rosetta Predictions human pricing
XM_001076680 Rosetta Predictions rat pricing
NM_024124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346123 predicted 900
2 SASI_Hs01_00165943 predicted 1427
3 SASI_Hs01_00165944 predicted 1446
4 SASI_Hs01_00165945 predicted 617
5 SASI_Hs01_00165946 predicted 744
6 SASI_Hs01_00165947 predicted 1441
7 SASI_Hs01_00165948 predicted 1602
8 SASI_Hs01_00165949 predicted 686
9 SASI_Hs01_00165950 predicted 1057
10 SASI_Hs01_00165951 predicted 611
11 SASI_Hs01_00165952 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362085 predicted 790
2 SASI_Hs01_00134839 predicted 1319
3 SASI_Hs01_00134840 predicted 1337
4 SASI_Hs01_00134841 predicted 510
5 SASI_Hs01_00134842 predicted 638
6 SASI_Hs01_00134843 predicted 1328
7 SASI_Hs01_00134844 predicted 1487
8 SASI_Hs01_00134845 predicted 584
9 SASI_Hs01_00134846 predicted 942
10 SASI_Hs01_00134847 predicted 505
11 SASI_Hs01_00134848 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362086 predicted 790
2 SASI_Hs01_00169283 predicted 1320
3 SASI_Hs01_00169284 predicted 1336
4 SASI_Hs01_00169285 predicted 506
5 SASI_Hs01_00169286 predicted 636
6 SASI_Hs01_00169287 predicted 1337
7 SASI_Hs01_00169288 predicted 1492
8 SASI_Hs01_00169289 predicted 576
9 SASI_Hs01_00169290 predicted 941
10 SASI_Hs01_00169291 predicted 509
11 SASI_Hs01_00169292 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369658 predicted 893
2 SASI_Hs01_00026207 predicted 1430
3 SASI_Hs01_00026208 predicted 1446
4 SASI_Hs01_00026209 predicted 614
5 SASI_Hs01_00026210 predicted 744
6 SASI_Hs01_00026211 predicted 1442
7 SASI_Hs01_00026212 predicted 1599
8 SASI_Hs01_00026213 predicted 693
9 SASI_Hs01_00026214 predicted 1053
10 SASI_Hs01_00026215 predicted 610
11 SASI_Hs01_00026216 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369659 predicted 800
2 SASI_Hs01_00097136 predicted 1330
3 SASI_Hs01_00097137 predicted 1345
4 SASI_Hs01_00097138 predicted 513
5 SASI_Hs01_00097139 predicted 652
6 SASI_Hs01_00097140 predicted 1342
7 SASI_Hs01_00097141 predicted 1500
8 SASI_Hs01_00097142 predicted 587
9 SASI_Hs01_00097143 predicted 953
10 SASI_Hs01_00097144 predicted 516
11 SASI_Hs01_00097145 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354120 predicted 756
2 SASI_Rn02_00354121 predicted 1258
3 SASI_Rn02_00354122 predicted 1590
4 SASI_Rn02_00354123 predicted 2810
5 SASI_Rn02_00354124 predicted 2696
6 SASI_Rn02_00354125 predicted 2824
7 SASI_Rn02_00354126 predicted 568
8 SASI_Rn02_00354127 predicted 370
9 SASI_Rn02_00354128 predicted 2966
10 SASI_Rn02_00354129 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144986 predicted 756
2 SASI_Mm01_00144987 predicted 757
3 SASI_Mm01_00144988 predicted 900
4 SASI_Mm02_00327465 predicted 1233
5 SASI_Mm01_00144990 predicted 1594
6 SASI_Mm02_00327466 predicted 757
7 SASI_Mm01_00144991 predicted 1081
8 SASI_Mm02_00327467 predicted 793
9 SASI_Mm01_00144993 predicted 1777
10 SASI_Mm01_00144994 predicted 739
11 SASI_Mm01_00144989 predicted 1349
12 SASI_Mm01_00144992 predicted 714
13 SASI_Mm01_00144995 predicted 1609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014707
VALIDATED
HDAC9 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 9
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1072s21c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1880s21c1
Sequence:CCGGGCAAAGATTTAGCTCCAGGATCTCGAGATCCTGGAGCTAAATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014707.1-2149s21c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1891s21c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-2149s1c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1605s1c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-994s1c1
Sequence:CCGGCCAACTGGAAGTGTTACTGAACTCGAGTTCAGTAACACTTCCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-1891s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-739s1c1
Sequence:CCGGCCATCCTACAAGTACACATTACTCGAGTAATGTGTACTTGTAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1072s1c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_014707.1-536s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014707.1-3334s1c1
Sequence:CCGGCCTAGAATCTTTGTGAGGTTTCTCGAGAAACCTCACAAAGATTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1605s21c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014707
VALIDATED
HDAC9 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 9
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1072s21c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1880s21c1
Sequence:CCGGGCAAAGATTTAGCTCCAGGATCTCGAGATCCTGGAGCTAAATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014707.1-2149s21c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1891s21c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-2149s1c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1605s1c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-994s1c1
Sequence:CCGGCCAACTGGAAGTGTTACTGAACTCGAGTTCAGTAACACTTCCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-1891s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-739s1c1
Sequence:CCGGCCATCCTACAAGTACACATTACTCGAGTAATGTGTACTTGTAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1072s1c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_014707.1-536s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014707.1-3334s1c1
Sequence:CCGGCCTAGAATCTTTGTGAGGTTTCTCGAGAAACCTCACAAAGATTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1605s21c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014707
VALIDATED
HDAC9 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 9
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1072s21c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1880s21c1
Sequence:CCGGGCAAAGATTTAGCTCCAGGATCTCGAGATCCTGGAGCTAAATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014707.1-2149s21c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1891s21c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-2149s1c1
Sequence:CCGGGAGCAGTTAATAGGCTTTAAACTCGAGTTTAAAGCCTATTAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1605s1c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-994s1c1
Sequence:CCGGCCAACTGGAAGTGTTACTGAACTCGAGTTCAGTAACACTTCCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-1891s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014707.1-739s1c1
Sequence:CCGGCCATCCTACAAGTACACATTACTCGAGTAATGTGTACTTGTAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014707.1-1072s1c1
Sequence:CCGGCGCATTCTAATTCATGAAGATCTCGAGATCTTCATGAATTAGAATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_014707.1-536s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014707.1-3334s1c1
Sequence:CCGGCCTAGAATCTTTGTGAGGTTTCTCGAGAAACCTCACAAAGATTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014707.1-1605s21c1
Sequence:CCGGCAAACTGCTTTCGAAATCTATCTCGAGATAGATTTCGAAAGCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024124
HDAC9 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-2297s1c1
Sequence:CCGGCCAAGTAATCAATAGGCTCTACTCGAGTAGAGCCTATTGATTACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-2051s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-1595s1c1
Sequence:CCGGGAAAGAATTTCACCAGGCATTCTCGAGAATGCCTGGTGAAATTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3800s1c1
Sequence:CCGGCCTTCTGATAATTTGACACATCTCGAGATGTGTCAAATTATCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-932s1c1
Sequence:CCGGGCTCAAGATAGCAAGGATGATCTCGAGATCATCCTTGCTATCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-702s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-569s1c1
Sequence:CCGGGAGCACATCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGATGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3381s1c1
Sequence:CCGGCCTCTGGAACATTTCCTTAATCTCGAGATTAAGGAAATGTTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024124
HDAC9 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-2297s1c1
Sequence:CCGGCCAAGTAATCAATAGGCTCTACTCGAGTAGAGCCTATTGATTACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-2051s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-1595s1c1
Sequence:CCGGGAAAGAATTTCACCAGGCATTCTCGAGAATGCCTGGTGAAATTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3800s1c1
Sequence:CCGGCCTTCTGATAATTTGACACATCTCGAGATGTGTCAAATTATCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-932s1c1
Sequence:CCGGGCTCAAGATAGCAAGGATGATCTCGAGATCATCCTTGCTATCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-702s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-569s1c1
Sequence:CCGGGAGCACATCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGATGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3381s1c1
Sequence:CCGGCCTCTGGAACATTTCCTTAATCTCGAGATTAAGGAAATGTTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024124
HDAC9 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-2297s1c1
Sequence:CCGGCCAAGTAATCAATAGGCTCTACTCGAGTAGAGCCTATTGATTACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-2051s1c1
Sequence:CCGGGCTCCAGGATTTGTAATTAAACTCGAGTTTAATTACAAATCCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-1595s1c1
Sequence:CCGGGAAAGAATTTCACCAGGCATTCTCGAGAATGCCTGGTGAAATTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3800s1c1
Sequence:CCGGCCTTCTGATAATTTGACACATCTCGAGATGTGTCAAATTATCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-932s1c1
Sequence:CCGGGCTCAAGATAGCAAGGATGATCTCGAGATCATCCTTGCTATCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-702s1c1
Sequence:CCGGGCAAAGATAGAGGACGAGAAACTCGAGTTTCTCGTCCTCTATCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024124.2-569s1c1
Sequence:CCGGGAGCACATCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGATGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024124.2-3381s1c1
Sequence:CCGGCCTCTGGAACATTTCCTTAATCTCGAGATTAAGGAAATGTTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)