EMAIL THIS PAGE TO A FRIEND

HDC

histidine decarboxylase

55 Gene Product Result for
UniProtKB ID: P19113, A1L4G0
Gene ID:
Human(3067) Summary: This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
Mouse(15186) histidine decarboxylase
Rat(24443) histidine decarboxylase
Zebrafish(793609) histidine decarboxylase
cow(515950) histidine decarboxylase
domestic cat(101096483) histidine decarboxylase
dog(487551) histidine decarboxylase
fruit fly(36076) Histidine decarboxylase
fruit fly(43604) headcase
chicken(415454) histidine decarboxylase
domestic guinea pig(100719978) histidine decarboxylase
naked mole-rat(101711940) histidine decarboxylase
sheep(101108052) histidine decarboxylase
Domestic Rabbit(100352602) histidine decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002112 Rosetta Predictions human pricing
NM_017016 Rosetta Predictions rat pricing
NM_008230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179250 predicted 1349
2 SASI_Hs01_00179251 predicted 549
3 SASI_Hs01_00179252 predicted 1182
4 SASI_Hs01_00179254 predicted 396
5 SASI_Hs01_00179255 predicted 820
6 SASI_Hs01_00179256 predicted 1238
7 SASI_Hs01_00179257 predicted 814
8 SASI_Hs01_00179258 predicted 912
9 SASI_Hs01_00179259 predicted 1277
10 SASI_Hs02_00333230 predicted 628
11 SASI_Hs01_00179253 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261179 predicted 1623
2 SASI_Rn01_00073515 predicted 1482
3 SASI_Rn01_00073516 predicted 1678
4 SASI_Rn02_00261180 predicted 1223
5 SASI_Rn02_00261181 predicted 788
6 SASI_Rn01_00073518 predicted 1810
7 SASI_Rn01_00073519 predicted 1340
8 SASI_Rn01_00073520 predicted 2107
9 SASI_Rn02_00261182 predicted 989
10 SASI_Rn02_00261183 predicted 1214
11 SASI_Rn01_00073517 predicted 1764
12 SASI_Rn01_00073521 predicted 1684
13 SASI_Rn01_00073522 predicted 1427
14 SASI_Rn01_00073523 predicted 1240
15 SASI_Rn01_00073524 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109606 predicted 1528
2 SASI_Mm01_00109607 predicted 1369
3 SASI_Mm01_00109608 predicted 831
4 SASI_Mm01_00109609 predicted 1495
5 SASI_Mm01_00109610 predicted 848
6 SASI_Mm01_00109611 predicted 1261
7 SASI_Mm01_00109612 predicted 1352
8 SASI_Mm01_00109613 predicted 1273
9 SASI_Mm02_00313418 predicted 1268
10 SASI_Mm02_00313419 predicted 1181
11 SASI_Mm01_00109614 predicted 1260
12 SASI_Mm01_00109615 predicted 2140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002112
HDC MISSION shRNA Bacterial Glycerol Stock
histidine decarboxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1414s1c1
Sequence:CCGGGCCACTATCCAGGACAAGTTACTCGAGTAACTTGTCCTGGATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002112.1-2106s1c1
Sequence:CCGGGCAGAGTCTGAGGATATACTTCTCGAGAAGTATATCCTCAGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-988s1c1
Sequence:CCGGGCCGACTCCTTCACCTTTAATCTCGAGATTAAAGGTGAAGGAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1338s21c1
Sequence:CCGGTTCGTCTAAAGGGTCCTAATTCTCGAGAATTAGGACCCTTTAGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1420s21c1
Sequence:CCGGCACTATCCAGGACAAGTTAATCTCGAGATTAACTTGTCCTGGATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1482s1c1
Sequence:CCGGCCTGAGAGACTGGAATCTCATCTCGAGATGAGATTCCAGTCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1246s21c1
Sequence:CCGGTGGTACTGAAATGGCTAAATACTCGAGTATTTAGCCATTTCAGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002112.2-2109s21c1
Sequence:CCGGAGCCAGAGTCTGAGGATATACCTCGAGGTATATCCTCAGACTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1163s1c2
Sequence:CCGGGCCGACGGTTTCGCTCTGTTACTCGAGTAACAGAGCGAAACCGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1185s21c1
Sequence:GTACCGGTTAAACTCTGGTTCGTGATTCCTCGAGGAATCACGAACCAGAGTTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002112
HDC MISSION shRNA shRNA Plasmid DNA
histidine decarboxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1414s1c1
Sequence:CCGGGCCACTATCCAGGACAAGTTACTCGAGTAACTTGTCCTGGATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002112.1-2106s1c1
Sequence:CCGGGCAGAGTCTGAGGATATACTTCTCGAGAAGTATATCCTCAGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-988s1c1
Sequence:CCGGGCCGACTCCTTCACCTTTAATCTCGAGATTAAAGGTGAAGGAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1338s21c1
Sequence:CCGGTTCGTCTAAAGGGTCCTAATTCTCGAGAATTAGGACCCTTTAGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1420s21c1
Sequence:CCGGCACTATCCAGGACAAGTTAATCTCGAGATTAACTTGTCCTGGATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1482s1c1
Sequence:CCGGCCTGAGAGACTGGAATCTCATCTCGAGATGAGATTCCAGTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1246s21c1
Sequence:CCGGTGGTACTGAAATGGCTAAATACTCGAGTATTTAGCCATTTCAGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002112.2-2109s21c1
Sequence:CCGGAGCCAGAGTCTGAGGATATACCTCGAGGTATATCCTCAGACTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1163s1c2
Sequence:CCGGGCCGACGGTTTCGCTCTGTTACTCGAGTAACAGAGCGAAACCGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1185s21c1
Sequence:GTACCGGTTAAACTCTGGTTCGTGATTCCTCGAGGAATCACGAACCAGAGTTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002112
HDC MISSION shRNA Lentiviral Transduction Particles
histidine decarboxylase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1414s1c1
Sequence:CCGGGCCACTATCCAGGACAAGTTACTCGAGTAACTTGTCCTGGATAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002112.1-2106s1c1
Sequence:CCGGGCAGAGTCTGAGGATATACTTCTCGAGAAGTATATCCTCAGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-988s1c1
Sequence:CCGGGCCGACTCCTTCACCTTTAATCTCGAGATTAAAGGTGAAGGAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1338s21c1
Sequence:CCGGTTCGTCTAAAGGGTCCTAATTCTCGAGAATTAGGACCCTTTAGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1420s21c1
Sequence:CCGGCACTATCCAGGACAAGTTAATCTCGAGATTAACTTGTCCTGGATAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1482s1c1
Sequence:CCGGCCTGAGAGACTGGAATCTCATCTCGAGATGAGATTCCAGTCTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1246s21c1
Sequence:CCGGTGGTACTGAAATGGCTAAATACTCGAGTATTTAGCCATTTCAGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002112.2-2109s21c1
Sequence:CCGGAGCCAGAGTCTGAGGATATACCTCGAGGTATATCCTCAGACTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002112.1-1163s1c2
Sequence:CCGGGCCGACGGTTTCGCTCTGTTACTCGAGTAACAGAGCGAAACCGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002112.2-1185s21c1
Sequence:GTACCGGTTAAACTCTGGTTCGTGATTCCTCGAGGAATCACGAACCAGAGTTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008230
HDC MISSION shRNA Bacterial Glycerol Stock
histidine decarboxylase
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000099528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1361s1c1
Sequence:CCGGGTCCTAATTGTCTCACAGAAACTCGAGTTTCTGTGAGACAATTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-564s1c1
Sequence:CCGGTGTCAGCGAATCCACTTTAATCTCGAGATTAAAGTGGATTCGCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1189s1c1
Sequence:CCGGCGCTCCATTAAGCTGTGGTTTCTCGAGAAACCACAGCTTAATGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008230
HDC MISSION shRNA shRNA Plasmid DNA
histidine decarboxylase
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000099528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1361s1c1
Sequence:CCGGGTCCTAATTGTCTCACAGAAACTCGAGTTTCTGTGAGACAATTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-564s1c1
Sequence:CCGGTGTCAGCGAATCCACTTTAATCTCGAGATTAAAGTGGATTCGCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1189s1c1
Sequence:CCGGCGCTCCATTAAGCTGTGGTTTCTCGAGAAACCACAGCTTAATGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008230
HDC MISSION shRNA Lentiviral Transduction Particles
histidine decarboxylase
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000099528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1361s1c1
Sequence:CCGGGTCCTAATTGTCTCACAGAAACTCGAGTTTCTGTGAGACAATTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-564s1c1
Sequence:CCGGTGTCAGCGAATCCACTTTAATCTCGAGATTAAAGTGGATTCGCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008230.4-1189s1c1
Sequence:CCGGCGCTCCATTAAGCTGTGGTTTCTCGAGAAACCACAGCTTAATGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)