EMAIL THIS PAGE TO A FRIEND

HDDC2

HD domain containing 2

53 Gene Product Result for
Synonyms: C6orf74 NS5ATP2 dJ167O5.2
UniProtKB ID: Q7Z4H3, Q5TDQ4, Q6NZ49, Q9BTT2, Q9BV31, Q9Y3D1
Gene ID:
Mouse(69692) HD domain containing 2
Rat(361462) HD domain containing 2
sheep(101118619) HD domain containing 2
domestic guinea pig(100727551) HD domain containing 2
naked mole-rat(101717485) HD domain containing 2
Zebrafish(554129) HD domain containing 2
domestic cat(101090360) HD domain containing 2
cow(509282) HD domain containing 2
dog(476281) HD domain containing 2
chicken(421719) HD domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016063 Rosetta Predictions human pricing
NM_001108460 Rosetta Predictions rat pricing
NM_027168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157531 predicted 360
2 SASI_Hs02_00348796 predicted 384
3 SASI_Hs02_00348797 predicted 563
4 SASI_Hs02_00348798 predicted 511
5 SASI_Hs01_00157533 predicted 881
6 SASI_Hs02_00348799 predicted 454
7 SASI_Hs01_00157534 predicted 548
8 SASI_Hs01_00157535 predicted 355
9 SASI_Hs01_00157538 predicted 736
10 SASI_Hs01_00157539 predicted 376
11 SASI_Hs01_00157532 predicted 522
12 SASI_Hs01_00157536 predicted 797
13 SASI_Hs01_00157537 predicted 710
14 SASI_Hs01_00157540 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238859 predicted 280
2 SASI_Rn02_00238860 predicted 211
3 SASI_Rn02_00238861 predicted 462
4 SASI_Rn02_00238862 predicted 322
5 SASI_Rn02_00238863 predicted 380
6 SASI_Rn02_00238864 predicted 334
7 SASI_Rn02_00238865 predicted 511
8 SASI_Rn02_00238866 predicted 397
9 SASI_Rn02_00238867 predicted 495
10 SASI_Rn02_00238868 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086538 predicted 477
2 SASI_Mm01_00086539 predicted 255
3 SASI_Mm02_00331686 predicted 290
4 SASI_Mm01_00086541 predicted 461
5 SASI_Mm01_00086542 predicted 305
6 SASI_Mm01_00086543 predicted 478
7 SASI_Mm01_00086544 predicted 431
8 SASI_Mm01_00086545 predicted 345
9 SASI_Mm01_00086546 predicted 301
10 SASI_Mm01_00086547 predicted 245
11 SASI_Mm01_00086540 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016063
VALIDATED
HDDC2 MISSION shRNA Bacterial Glycerol Stock
HD domain containing 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-737s21c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-589s21c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-627s21c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-610s21c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-346s1c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1021s1c1
Sequence:CCGGCCCAGATGAAATTGCTGCCTTCTCGAGAAGGCAGCAATTTCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-494s1c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-324s1c1
Sequence:CCGGCTATGAACTTTGGGAAGAGTACTCGAGTACTCTTCCCAAAGTTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-511s1c1
Sequence:CCGGGTTTCTGAACTTGAGGCAGAACTCGAGTTCTGCCTCAAGTTCAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1022s1c1
Sequence:CCGGCCAGATGAAATTGCTGCCTTACTCGAGTAAGGCAGCAATTTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016063.1-253s1c1
Sequence:CCGGCGTCTTAACAAAGACCCGGAACTCGAGTTCCGGGTCTTTGTTAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-367s1c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-887s21c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-384s1c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-644s1c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016063
VALIDATED
HDDC2 MISSION shRNA shRNA Plasmid DNA
HD domain containing 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-737s21c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-589s21c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-627s21c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-610s21c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-346s1c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1021s1c1
Sequence:CCGGCCCAGATGAAATTGCTGCCTTCTCGAGAAGGCAGCAATTTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-494s1c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-324s1c1
Sequence:CCGGCTATGAACTTTGGGAAGAGTACTCGAGTACTCTTCCCAAAGTTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-511s1c1
Sequence:CCGGGTTTCTGAACTTGAGGCAGAACTCGAGTTCTGCCTCAAGTTCAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1022s1c1
Sequence:CCGGCCAGATGAAATTGCTGCCTTACTCGAGTAAGGCAGCAATTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016063.1-253s1c1
Sequence:CCGGCGTCTTAACAAAGACCCGGAACTCGAGTTCCGGGTCTTTGTTAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-367s1c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-887s21c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-384s1c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-644s1c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016063
VALIDATED
HDDC2 MISSION shRNA Lentiviral Transduction Particles
HD domain containing 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-737s21c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-589s21c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-627s21c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-610s21c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-346s1c1
Sequence:CCGGGAGACCCAATCTAGTGCAGAACTCGAGTTCTGCACTAGATTGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1021s1c1
Sequence:CCGGCCCAGATGAAATTGCTGCCTTCTCGAGAAGGCAGCAATTTCATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-494s1c1
Sequence:CCGGCTGAGATAGTCCAGCTTGTTTCTCGAGAAACAAGCTGGACTATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-324s1c1
Sequence:CCGGCTATGAACTTTGGGAAGAGTACTCGAGTACTCTTCCCAAAGTTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-511s1c1
Sequence:CCGGGTTTCTGAACTTGAGGCAGAACTCGAGTTCTGCCTCAAGTTCAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016063.1-1022s1c1
Sequence:CCGGCCAGATGAAATTGCTGCCTTACTCGAGTAAGGCAGCAATTTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016063.1-253s1c1
Sequence:CCGGCGTCTTAACAAAGACCCGGAACTCGAGTTCCGGGTCTTTGTTAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-367s1c1
Sequence:CCGGGCCAAATTTGTGAAGCAGCTACTCGAGTAGCTGCTTCACAAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016063.2-887s21c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-384s1c1
Sequence:CCGGGCTAGACCAATGTGAAATGATCTCGAGATCATTTCACATTGGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016063.1-644s1c1
Sequence:CCGGCCATTGTTGGTCTGTTGATTTCTCGAGAAATCAACAGACCAACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027168
HDDC2 MISSION shRNA Bacterial Glycerol Stock
HD domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-250s21c1
Sequence:CCGGGGACATAGCACCCGCAGATAACTCGAGTTATCTGCGGGTGCTATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-172s21c1
Sequence:CCGGGACCAGAGATGACCGTCTTAACTCGAGTTAAGACGGTCATCTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-142s21c1
Sequence:CCGGCATGTACCGGATGGCAGTTATCTCGAGATAACTGCCATCCGGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-394s1c1
Sequence:CCGGCGAAGAAGCCAAATTCGTGAACTCGAGTTCACGAATTTGGCTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-342s21c1
Sequence:CCGGACCTCAGGAAGGAGCTATATGCTCGAGCATATAGCTCCTTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-211s21c1
Sequence:CCGGCCTAGCCCTGGTTCACGATATCTCGAGATATCGTGAACCAGGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-446s1c1
Sequence:CCGGGCCTCAGAATATGAAGACCTACTCGAGTAGGTCTTCATATTCTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027168
HDDC2 MISSION shRNA shRNA Plasmid DNA
HD domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-250s21c1
Sequence:CCGGGGACATAGCACCCGCAGATAACTCGAGTTATCTGCGGGTGCTATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-172s21c1
Sequence:CCGGGACCAGAGATGACCGTCTTAACTCGAGTTAAGACGGTCATCTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-142s21c1
Sequence:CCGGCATGTACCGGATGGCAGTTATCTCGAGATAACTGCCATCCGGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-394s1c1
Sequence:CCGGCGAAGAAGCCAAATTCGTGAACTCGAGTTCACGAATTTGGCTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-342s21c1
Sequence:CCGGACCTCAGGAAGGAGCTATATGCTCGAGCATATAGCTCCTTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-211s21c1
Sequence:CCGGCCTAGCCCTGGTTCACGATATCTCGAGATATCGTGAACCAGGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-446s1c1
Sequence:CCGGGCCTCAGAATATGAAGACCTACTCGAGTAGGTCTTCATATTCTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027168
HDDC2 MISSION shRNA Lentiviral Transduction Particles
HD domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-250s21c1
Sequence:CCGGGGACATAGCACCCGCAGATAACTCGAGTTATCTGCGGGTGCTATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-172s21c1
Sequence:CCGGGACCAGAGATGACCGTCTTAACTCGAGTTAAGACGGTCATCTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-142s21c1
Sequence:CCGGCATGTACCGGATGGCAGTTATCTCGAGATAACTGCCATCCGGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-394s1c1
Sequence:CCGGCGAAGAAGCCAAATTCGTGAACTCGAGTTCACGAATTTGGCTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-342s21c1
Sequence:CCGGACCTCAGGAAGGAGCTATATGCTCGAGCATATAGCTCCTTCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027168.2-211s21c1
Sequence:CCGGCCTAGCCCTGGTTCACGATATCTCGAGATATCGTGAACCAGGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027168.1-446s1c1
Sequence:CCGGGCCTCAGAATATGAAGACCTACTCGAGTAGGTCTTCATATTCTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)