EMAIL THIS PAGE TO A FRIEND

HDDC3

HD domain containing 3

68 Gene Product Result for
Synonyms: MESH1
UniProtKB ID: Q8N4P3
Gene ID:
Mouse(68695) HD domain containing 3
Rat(308758) HD domain containing 3
Zebrafish(550533) HD domain containing 3
cow(613382) HD domain containing 3
domestic cat(101080290) HD domain containing 3
dog(488744) HD domain containing 3
domestic guinea pig(100734745) HD domain containing 3
naked mole-rat(101716057) HD domain containing 3
sheep(101106548) HD domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198527 Rosetta Predictions human pricing
NM_001107528 Rosetta Predictions rat pricing
NM_026812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101056 predicted 359
2 SASI_Hs01_00101057 predicted 785
3 SASI_Hs01_00101058 predicted 451
4 SASI_Hs01_00101059 predicted 631
5 SASI_Hs02_00372108 predicted 742
6 SASI_Hs01_00101061 predicted 794
7 SASI_Hs01_00101062 predicted 536
8 SASI_Hs01_00101063 predicted 531
9 SASI_Hs01_00101064 predicted 651
10 SASI_Hs01_00101065 predicted 544
11 SASI_Hs01_00101060 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229715 predicted 1045
2 SASI_Rn02_00229716 predicted 741
3 SASI_Rn02_00229717 predicted 375
4 SASI_Rn02_00229718 predicted 865
5 SASI_Rn02_00229719 predicted 722
6 SASI_Rn02_00229720 predicted 611
7 SASI_Rn02_00229721 predicted 875
8 SASI_Rn02_00229722 predicted 640
9 SASI_Rn02_00229723 predicted 822
10 SASI_Rn02_00229724 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086672 predicted 483
2 SASI_Mm01_00086673 predicted 424
3 SASI_Mm01_00086675 predicted 621
4 SASI_Mm01_00086676 predicted 493
5 SASI_Mm01_00086677 predicted 354
6 SASI_Mm01_00086678 predicted 373
7 SASI_Mm01_00086679 predicted 352
8 SASI_Mm02_00330943 predicted 613
9 SASI_Mm02_00330944 predicted 606
10 SASI_Mm01_00086680 predicted 257
11 SASI_Mm01_00086674 predicted 590
12 SASI_Mm01_00086681 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198527
HDDC3 MISSION shRNA Bacterial Glycerol Stock
HD domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-141s21c1
Sequence:CCGGAGGCGGGAATCACTGACATTGCTCGAGCAATGTCAGTGATTCCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198527.2-787s21c1
Sequence:CCGGCTCCATCCTTCCCAGATATTACTCGAGTAATATCTGGGAAGGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-219s21c1
Sequence:CCGGATGAGGTGGAGCTACACTTTGCTCGAGCAAAGTGTAGCTCCACCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-257s21c1
Sequence:CCGGCTGGTGGAGGAGGTAACAGATCTCGAGATCTGTTACCTCCTCCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-378s21c1
Sequence:CCGGACAATCTGAGGGACCTGAATCCTCGAGGATTCAGGTCCCTCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198527
HDDC3 MISSION shRNA shRNA Plasmid DNA
HD domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-141s21c1
Sequence:CCGGAGGCGGGAATCACTGACATTGCTCGAGCAATGTCAGTGATTCCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198527.2-787s21c1
Sequence:CCGGCTCCATCCTTCCCAGATATTACTCGAGTAATATCTGGGAAGGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-219s21c1
Sequence:CCGGATGAGGTGGAGCTACACTTTGCTCGAGCAAAGTGTAGCTCCACCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-257s21c1
Sequence:CCGGCTGGTGGAGGAGGTAACAGATCTCGAGATCTGTTACCTCCTCCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-378s21c1
Sequence:CCGGACAATCTGAGGGACCTGAATCCTCGAGGATTCAGGTCCCTCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198527
HDDC3 MISSION shRNA Lentiviral Transduction Particles
HD domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-141s21c1
Sequence:CCGGAGGCGGGAATCACTGACATTGCTCGAGCAATGTCAGTGATTCCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198527.2-787s21c1
Sequence:CCGGCTCCATCCTTCCCAGATATTACTCGAGTAATATCTGGGAAGGATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-219s21c1
Sequence:CCGGATGAGGTGGAGCTACACTTTGCTCGAGCAAAGTGTAGCTCCACCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-257s21c1
Sequence:CCGGCTGGTGGAGGAGGTAACAGATCTCGAGATCTGTTACCTCCTCCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198527.2-378s21c1
Sequence:CCGGACAATCTGAGGGACCTGAATCCTCGAGGATTCAGGTCCCTCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026812
HDDC3 MISSION shRNA Bacterial Glycerol Stock
HD domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-699s1c1
Sequence:CCGGCCCGGAATATGGAAAGCAGATCTCGAGATCTGCTTTCCATATTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-584s1c1
Sequence:CCGGCCAGGAAAGATGGGATTCTTACTCGAGTAAGAATCCCATCTTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-371s1c1
Sequence:CCGGGCTATACAATCTGAGGGACCTCTCGAGAGGTCCCTCAGATTGTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-359s1c1
Sequence:CCGGGCTGGCAGACAAGCTATACAACTCGAGTTGTATAGCTTGTCTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-82s1c1
Sequence:CCGGCTGAAGGGACTCCCTACATTACTCGAGTAATGTAGGGAGTCCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026812
HDDC3 MISSION shRNA shRNA Plasmid DNA
HD domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-699s1c1
Sequence:CCGGCCCGGAATATGGAAAGCAGATCTCGAGATCTGCTTTCCATATTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-584s1c1
Sequence:CCGGCCAGGAAAGATGGGATTCTTACTCGAGTAAGAATCCCATCTTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-371s1c1
Sequence:CCGGGCTATACAATCTGAGGGACCTCTCGAGAGGTCCCTCAGATTGTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-359s1c1
Sequence:CCGGGCTGGCAGACAAGCTATACAACTCGAGTTGTATAGCTTGTCTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-82s1c1
Sequence:CCGGCTGAAGGGACTCCCTACATTACTCGAGTAATGTAGGGAGTCCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026812
HDDC3 MISSION shRNA Lentiviral Transduction Particles
HD domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-699s1c1
Sequence:CCGGCCCGGAATATGGAAAGCAGATCTCGAGATCTGCTTTCCATATTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026812.1-584s1c1
Sequence:CCGGCCAGGAAAGATGGGATTCTTACTCGAGTAAGAATCCCATCTTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-371s1c1
Sequence:CCGGGCTATACAATCTGAGGGACCTCTCGAGAGGTCCCTCAGATTGTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-359s1c1
Sequence:CCGGGCTGGCAGACAAGCTATACAACTCGAGTTGTATAGCTTGTCTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026812.1-82s1c1
Sequence:CCGGCTGAAGGGACTCCCTACATTACTCGAGTAATGTAGGGAGTCCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)