EMAIL THIS PAGE TO A FRIEND

HDGF

hepatoma-derived growth factor

127 Gene Product Result for
Synonyms: HMG1L2
UniProtKB ID: P51858, B3KU21, D3DVC9, Q5SZ07, Q5SZ08, Q5SZ09
Gene ID:
Human(3068) Summary: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. This gene was thought initially to be located on chromosome X, however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(15191) hepatoma-derived growth factor
Rat(114499) hepatoma-derived growth factor
chicken(776936) hepatoma-derived growth factor
cow(327953) hepatoma-derived growth factor
domestic cat(101082623) hepatoma-derived growth factor
dog(612089) hepatoma-derived growth factor
sheep(101109237) hepatoma-derived growth factor
domestic guinea pig(100715722) hepatoma-derived growth factor
naked mole-rat(101723126) hepatoma-derived growth factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126050 Rosetta Predictions human pricing
NM_001126051 Rosetta Predictions human pricing
NM_004494 Rosetta Predictions human pricing
NM_053707 Rosetta Predictions rat pricing
NM_008231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328007 predicted 1083
2 SASI_Hs02_00328008 predicted 1176
3 SASI_Hs02_00328009 predicted 485
4 SASI_Hs02_00328010 predicted 1116
5 SASI_Hs02_00328011 predicted 1243
6 SASI_Hs02_00328012 predicted 558
7 SASI_Hs02_00328013 predicted 132
8 SASI_Hs02_00328014 predicted 961
9 SASI_Hs02_00328015 predicted 427
10 SASI_Hs02_00328016 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328017 predicted 1054
2 SASI_Hs02_00328018 predicted 1158
3 SASI_Hs02_00328019 predicted 452
4 SASI_Hs02_00328020 predicted 1084
5 SASI_Hs02_00328021 predicted 1210
6 SASI_Hs02_00328022 predicted 537
7 SASI_Hs02_00328023 predicted 395
8 SASI_Hs02_00328024 predicted 1051
9 SASI_Hs02_00328025 predicted 803
10 SASI_Hs02_00328026 predicted 153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221148 predicted 1269
2 SASI_Hs01_00221150 predicted 1371
3 SASI_Hs01_00221151 predicted 674
4 SASI_Hs02_00337740 predicted 1302
5 SASI_Hs02_00337741 predicted 1429
6 SASI_Hs01_00221154 predicted 748
7 SASI_Hs01_00221155 predicted 1155
8 SASI_Hs01_00221156 predicted 611
9 SASI_Hs01_00221149 predicted 1264
10 SASI_Hs01_00221157 predicted 1020
11 SASI_Hs01_00221152 predicted 1192
12 SASI_Hs01_00221153 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084487 predicted 1096
2 SASI_Rn01_00084488 predicted 977
3 SASI_Rn01_00084489 predicted 1429
4 SASI_Rn01_00084490 predicted 1086
5 SASI_Rn01_00084491 predicted 1216
6 SASI_Rn01_00084492 predicted 1077
7 SASI_Rn01_00084493 predicted 1470
8 SASI_Rn01_00084494 predicted 1484
9 SASI_Rn01_00084495 predicted 959
10 SASI_Rn01_00084496 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091882 predicted 1102
2 SASI_Mm01_00091883 predicted 1091
3 SASI_Mm01_00091884 predicted 1467
4 SASI_Mm01_00091885 predicted 1498
5 SASI_Mm01_00091886 predicted 1498
6 SASI_Mm01_00091887 predicted 1483
7 SASI_Mm01_00091888 predicted 1237
8 SASI_Mm02_00313420 predicted 812
9 SASI_Mm01_00091889 predicted 1248
10 SASI_Mm01_00091890 predicted 710
11 SASI_Mm01_00091881 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008231
VALIDATED
HDGF MISSION shRNA Bacterial Glycerol Stock
hepatoma-derived growth factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-2003s1c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-309s1c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-667s1c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-528s1c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-385s1c1
Sequence:CCGGGCCAACAAATACCAAGTCTTTCTCGAGAAAGACTTGGTATTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-574s21c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-355s21c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-713s21c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008231.4-2049s21c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008231
VALIDATED
HDGF MISSION shRNA shRNA Plasmid DNA
hepatoma-derived growth factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-2003s1c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-309s1c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-667s1c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-528s1c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-385s1c1
Sequence:CCGGGCCAACAAATACCAAGTCTTTCTCGAGAAAGACTTGGTATTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-574s21c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-355s21c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-713s21c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008231.4-2049s21c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008231
VALIDATED
HDGF MISSION shRNA Lentiviral Transduction Particles
hepatoma-derived growth factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-2003s1c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-309s1c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-667s1c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-528s1c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008231.2-385s1c1
Sequence:CCGGGCCAACAAATACCAAGTCTTTCTCGAGAAAGACTTGGTATTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-574s21c1
Sequence:CCGGCGAGAACAACCCTACAGTCAACTCGAGTTGACTGTAGGGTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-355s21c1
Sequence:CCGGGTTTGCGAAGATGAAAGGATACTCGAGTATCCTTTCATCTTCGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008231.4-713s21c1
Sequence:CCGGGAAGGGAAACTGGTGATCGATCTCGAGATCGATCACCAGTTTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008231.4-2049s21c1
Sequence:CCGGCCCACTAAGAATACAGGGAAACTCGAGTTTCCCTGTATTCTTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004494
VALIDATED
HDGF MISSION shRNA Bacterial Glycerol Stock
hepatoma-derived growth factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-759s1c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-423s1c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-504s1c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-582s1c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004494.1-1869s1c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-511s21c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-766s21c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004494.2-430s21c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-1877s21c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-589s21c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004494
VALIDATED
HDGF MISSION shRNA shRNA Plasmid DNA
hepatoma-derived growth factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-759s1c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-423s1c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-504s1c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-582s1c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004494.1-1869s1c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-511s21c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-766s21c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004494.2-430s21c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-1877s21c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-589s21c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004494
VALIDATED
HDGF MISSION shRNA Lentiviral Transduction Particles
hepatoma-derived growth factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-759s1c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-423s1c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004494.1-504s1c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004494.1-582s1c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004494.1-1869s1c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-511s21c1
Sequence:CCGGCTTCCCTTACGAGGAATCCAACTCGAGTTGGATTCCTCGTAAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-766s21c1
Sequence:CCGGGAACGAGAAAGGAGCGTTGAACTCGAGTTCAACGCTCCTTTCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004494.2-430s21c1
Sequence:CCGGTGCCGTGAAATCAACAGCCAACTCGAGTTGGCTGTTGATTTCACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-1877s21c1
Sequence:CCGGGCCAGCTTATAGTCATATATACTCGAGTATATATGACTATAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004494.2-589s21c1
Sequence:CCGGCGAGAACAACCCTACTGTCAACTCGAGTTGACAGTAGGGTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)