EMAIL THIS PAGE TO A FRIEND

HDGFL1

hepatoma derived growth factor-like 1

51 Gene Product Result for
Synonyms: PWWP1 dJ309H15.1
UniProtKB ID: Q5TGJ6, Q96MJ6
Gene ID:
Mouse(15192) hepatoma derived growth factor-like 1
Rat(171074) hepatoma derived growth factor-like 1
domestic guinea pig(100734344) hepatoma derived growth factor-like 1
sheep(101110713) hepatoma derived growth factor-like 1
dog(610811) hepatoma derived growth factor-like 1
cow(407143) hepatoma derived growth factor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063861 MISSION® esiRNA esiRNA targeting mouse Hdgfl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138574 Rosetta Predictions human pricing
NM_133549 Rosetta Predictions rat pricing
NM_008232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077551 predicted 279
2 SASI_Hs02_00363722 predicted 225
3 SASI_Hs02_00363723 predicted 199
4 SASI_Hs01_00077552 predicted 291
5 SASI_Hs02_00363724 predicted 225
6 SASI_Hs02_00363725 predicted 203
7 SASI_Hs02_00363726 predicted 389
8 SASI_Hs02_00363727 predicted 329
9 SASI_Hs02_00363728 predicted 200
10 SASI_Hs02_00363729 predicted 411
11 SASI_Hs01_00077548 predicted 1261
12 SASI_Hs01_00077549 predicted 751
13 SASI_Hs01_00077550 predicted 1137
14 SASI_Hs01_00077553 predicted 1144
15 SASI_Hs01_00077554 predicted 1022
16 SASI_Hs01_00077555 predicted 1116
17 SASI_Hs01_00077556 predicted 764
18 SASI_Hs01_00077557 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267736 predicted 1344
2 SASI_Rn01_00031309 predicted 1093
3 SASI_Rn01_00031310 predicted 1197
4 SASI_Rn01_00031311 predicted 1096
5 SASI_Rn01_00031312 predicted 1024
6 SASI_Rn01_00031314 predicted 1348
7 SASI_Rn01_00031315 predicted 1034
8 SASI_Rn01_00031316 predicted 937
9 SASI_Rn01_00031317 predicted 1409
10 SASI_Rn01_00031318 predicted 850
11 SASI_Rn01_00031313 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033277 predicted 942
2 SASI_Mm01_00033278 predicted 1041
3 SASI_Mm01_00033279 predicted 349
4 SASI_Mm01_00033280 predicted 1041
5 SASI_Mm01_00033281 predicted 203
6 SASI_Mm01_00033282 predicted 297
7 SASI_Mm01_00033283 predicted 1032
8 SASI_Mm01_00033284 predicted 980
9 SASI_Mm01_00033285 predicted 236
10 SASI_Mm01_00033286 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138574
HDGFL1 MISSION shRNA Bacterial Glycerol Stock
hepatoma derived growth factor-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-180s21c1
Sequence:CCGGAGTTAAAGGGCTATGCCCACTCTCGAGAGTGGGCATAGCCCTTTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-878s21c1
Sequence:CCGGCTGTAGTTACCAGCGTTTCCACTCGAGTGGAAACGCTGGTAACTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138574.2-946s21c1
Sequence:CCGGATCTGACCACGGCGTGCAAACCTCGAGGTTTGCACGCCGTGGTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138574.1-1719s1c1
Sequence:CCGGGCTCCCTTTCTGTTTGAAGTTCTCGAGAACTTCAAACAGAAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-113s1c1
Sequence:CCGGCCCAACCGCTACCAGGTGTTTCTCGAGAAACACCTGGTAGCGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-286s1c1
Sequence:CCGGCTGCCCATTAGCCTCAGAGAACTCGAGTTCTCTGAGGCTAATGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-178s1c1
Sequence:CCGGGTTCCCGTACAAGGAGTGCAACTCGAGTTGCACTCCTTGTACGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138574
HDGFL1 MISSION shRNA shRNA Plasmid DNA
hepatoma derived growth factor-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-180s21c1
Sequence:CCGGAGTTAAAGGGCTATGCCCACTCTCGAGAGTGGGCATAGCCCTTTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-878s21c1
Sequence:CCGGCTGTAGTTACCAGCGTTTCCACTCGAGTGGAAACGCTGGTAACTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138574.2-946s21c1
Sequence:CCGGATCTGACCACGGCGTGCAAACCTCGAGGTTTGCACGCCGTGGTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138574.1-1719s1c1
Sequence:CCGGGCTCCCTTTCTGTTTGAAGTTCTCGAGAACTTCAAACAGAAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-113s1c1
Sequence:CCGGCCCAACCGCTACCAGGTGTTTCTCGAGAAACACCTGGTAGCGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-286s1c1
Sequence:CCGGCTGCCCATTAGCCTCAGAGAACTCGAGTTCTCTGAGGCTAATGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-178s1c1
Sequence:CCGGGTTCCCGTACAAGGAGTGCAACTCGAGTTGCACTCCTTGTACGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138574
HDGFL1 MISSION shRNA Lentiviral Transduction Particles
hepatoma derived growth factor-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-180s21c1
Sequence:CCGGAGTTAAAGGGCTATGCCCACTCTCGAGAGTGGGCATAGCCCTTTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138574.2-878s21c1
Sequence:CCGGCTGTAGTTACCAGCGTTTCCACTCGAGTGGAAACGCTGGTAACTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138574.2-946s21c1
Sequence:CCGGATCTGACCACGGCGTGCAAACCTCGAGGTTTGCACGCCGTGGTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138574.1-1719s1c1
Sequence:CCGGGCTCCCTTTCTGTTTGAAGTTCTCGAGAACTTCAAACAGAAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-113s1c1
Sequence:CCGGCCCAACCGCTACCAGGTGTTTCTCGAGAAACACCTGGTAGCGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-286s1c1
Sequence:CCGGCTGCCCATTAGCCTCAGAGAACTCGAGTTCTCTGAGGCTAATGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138574.1-178s1c1
Sequence:CCGGGTTCCCGTACAAGGAGTGCAACTCGAGTTGCACTCCTTGTACGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008232
HDGFL1 MISSION shRNA Bacterial Glycerol Stock
hepatoma derived growth factor-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-730s21c1
Sequence:CCGGAGCCTCATTGTCCTCTCAAACCTCGAGGTTTGAGAGGACAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008232.3-1042s21c1
Sequence:CCGGTCGCCTTCTACAAGCCTAAATCTCGAGATTTAGGCTTGTAGAAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-896s21c1
Sequence:CCGGGGGCCTGATTGTTGGAGAAATCTCGAGATTTCTCCAACAATCAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008232.1-997s1c1
Sequence:CCGGCGCCTTCTACAAGCCTAAATTCTCGAGAATTTAGGCTTGTAGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-682s1c1
Sequence:CCGGAGAGCCTCATTGTCCTCTCAACTCGAGTTGAGAGGACAATGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-113s1c1
Sequence:CCGGAGGATCGAACATGTCGCTGAACTCGAGTTCAGCGACATGTTCGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-848s1c1
Sequence:CCGGCAGGGCCTGATTGTTGGAGAACTCGAGTTCTCCAACAATCAGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-214s1c1
Sequence:CCGGGTCCAAAGAGAAGTTCGGCAACTCGAGTTGCCGAACTTCTCTTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008232
HDGFL1 MISSION shRNA shRNA Plasmid DNA
hepatoma derived growth factor-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-730s21c1
Sequence:CCGGAGCCTCATTGTCCTCTCAAACCTCGAGGTTTGAGAGGACAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008232.3-1042s21c1
Sequence:CCGGTCGCCTTCTACAAGCCTAAATCTCGAGATTTAGGCTTGTAGAAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-896s21c1
Sequence:CCGGGGGCCTGATTGTTGGAGAAATCTCGAGATTTCTCCAACAATCAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008232.1-997s1c1
Sequence:CCGGCGCCTTCTACAAGCCTAAATTCTCGAGAATTTAGGCTTGTAGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-682s1c1
Sequence:CCGGAGAGCCTCATTGTCCTCTCAACTCGAGTTGAGAGGACAATGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-113s1c1
Sequence:CCGGAGGATCGAACATGTCGCTGAACTCGAGTTCAGCGACATGTTCGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-848s1c1
Sequence:CCGGCAGGGCCTGATTGTTGGAGAACTCGAGTTCTCCAACAATCAGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-214s1c1
Sequence:CCGGGTCCAAAGAGAAGTTCGGCAACTCGAGTTGCCGAACTTCTCTTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008232
HDGFL1 MISSION shRNA Lentiviral Transduction Particles
hepatoma derived growth factor-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-730s21c1
Sequence:CCGGAGCCTCATTGTCCTCTCAAACCTCGAGGTTTGAGAGGACAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008232.3-1042s21c1
Sequence:CCGGTCGCCTTCTACAAGCCTAAATCTCGAGATTTAGGCTTGTAGAAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008232.3-896s21c1
Sequence:CCGGGGGCCTGATTGTTGGAGAAATCTCGAGATTTCTCCAACAATCAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008232.1-997s1c1
Sequence:CCGGCGCCTTCTACAAGCCTAAATTCTCGAGAATTTAGGCTTGTAGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-682s1c1
Sequence:CCGGAGAGCCTCATTGTCCTCTCAACTCGAGTTGAGAGGACAATGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-113s1c1
Sequence:CCGGAGGATCGAACATGTCGCTGAACTCGAGTTCAGCGACATGTTCGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-848s1c1
Sequence:CCGGCAGGGCCTGATTGTTGGAGAACTCGAGTTCTCCAACAATCAGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008232.1-214s1c1
Sequence:CCGGGTCCAAAGAGAAGTTCGGCAACTCGAGTTGCCGAACTTCTCTTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)