EMAIL THIS PAGE TO A FRIEND

HDGFRP2

62 Gene Product Result for
Synonyms: HDGF2
UniProtKB ID: Q7Z4V5, I3L080, Q96GI5, Q9BW08
Gene ID:
Human(84717) Summary: This gene encodes a member of the hepatoma-derived growth factor (HDGF) family. Two alternatively spliced transcript variants encoding slightly different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15193) hepatoma-derived growth factor, related protein 2
Rat(171073) hepatoma-derived growth factor-related protein 2
Zebrafish(80965) hepatoma-derived growth factor, related protein 2
cow(512959) hepatoma-derived growth factor-related protein 2
dog(485036) hepatoma-derived growth factor-related protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013431 MISSION® esiRNA esiRNA targeting mouse Hdgfrp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001520 Rosetta Predictions human pricing
NM_032631 Rosetta Predictions human pricing
NM_133548 Rosetta Predictions rat pricing
NM_008233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211871 predicted 1525
2 SASI_Hs01_00211872 predicted 515
3 SASI_Hs01_00211873 predicted 1423
4 SASI_Hs01_00211874 predicted 426
5 SASI_Hs01_00211875 predicted 1524
6 SASI_Hs01_00211876 predicted 539
7 SASI_Hs01_00211877 predicted 1515
8 SASI_Hs01_00211878 predicted 1363
9 SASI_Hs01_00211879 predicted 528
10 SASI_Hs01_00211880 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117338 predicted 1527
2 SASI_Hs01_00117339 predicted 511
3 SASI_Hs01_00117340 predicted 1419
4 SASI_Hs01_00117341 predicted 429
5 SASI_Hs01_00117342 predicted 1524
6 SASI_Hs01_00117343 predicted 540
7 SASI_Hs01_00117344 predicted 1512
8 SASI_Hs01_00117345 predicted 1361
9 SASI_Hs01_00117346 predicted 525
10 SASI_Hs01_00117347 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081525 predicted 795
2 SASI_Rn01_00081526 predicted 479
3 SASI_Rn01_00081527 predicted 1566
4 SASI_Rn01_00081528 predicted 498
5 SASI_Rn01_00081529 predicted 1223
6 SASI_Rn01_00081530 predicted 582
7 SASI_Rn01_00081531 predicted 1432
8 SASI_Rn01_00081532 predicted 740
9 SASI_Rn01_00081533 predicted 436
10 SASI_Rn01_00081534 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174330 predicted 574
2 SASI_Mm01_00174331 predicted 1221
3 SASI_Mm01_00174332 predicted 1664
4 SASI_Mm01_00174333 predicted 926
5 SASI_Mm02_00313421 predicted 524
6 SASI_Mm01_00174334 predicted 1523
7 SASI_Mm01_00174335 predicted 835
8 SASI_Mm01_00174337 predicted 1551
9 SASI_Mm01_00174338 predicted 1994
10 SASI_Mm02_00313422 predicted 531
11 SASI_Mm01_00174336 predicted 2027
12 SASI_Mm01_00174339 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032631
VALIDATED
HDGFRP2 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1634s21c1
Sequence:CCGGAGAAGAACACAGACGTGGTGGCTCGAGCCACCACGTCTGTGTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-293s21c1
Sequence:CCGGAGTACGGGAAGCCCAACAAGACTCGAGTCTTGTTGGGCTTCCCGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1542s21c1
Sequence:CCGGGTTTGCCCTAAAGGTCGACAGCTCGAGCTGTCGACCTTTAGGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-2169s1c1
Sequence:CCGGGCAGGAGAGCAGAGCAGAGAACTCGAGTTCTCTGCTCTGCTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-576s1c1
Sequence:CCGGGCTAAAGATGTCGGTCTCGAACTCGAGTTCGAGACCGACATCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1659s1c1
Sequence:CCGGCTTGAAGAAGATTCGCCGTTACTCGAGTAACGGCGAATCTTCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1680s1c1
Sequence:CCGGCAAAGCGAACAAGGACGTAATCTCGAGATTACGTCCTTGTTCGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-1662s1c1
Sequence:CCGGGAAGAAGATTCGCCGTTACAACTCGAGTTGTAACGGCGAATCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032631
VALIDATED
HDGFRP2 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1634s21c1
Sequence:CCGGAGAAGAACACAGACGTGGTGGCTCGAGCCACCACGTCTGTGTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-293s21c1
Sequence:CCGGAGTACGGGAAGCCCAACAAGACTCGAGTCTTGTTGGGCTTCCCGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1542s21c1
Sequence:CCGGGTTTGCCCTAAAGGTCGACAGCTCGAGCTGTCGACCTTTAGGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-2169s1c1
Sequence:CCGGGCAGGAGAGCAGAGCAGAGAACTCGAGTTCTCTGCTCTGCTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-576s1c1
Sequence:CCGGGCTAAAGATGTCGGTCTCGAACTCGAGTTCGAGACCGACATCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1659s1c1
Sequence:CCGGCTTGAAGAAGATTCGCCGTTACTCGAGTAACGGCGAATCTTCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1680s1c1
Sequence:CCGGCAAAGCGAACAAGGACGTAATCTCGAGATTACGTCCTTGTTCGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-1662s1c1
Sequence:CCGGGAAGAAGATTCGCCGTTACAACTCGAGTTGTAACGGCGAATCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032631
VALIDATED
HDGFRP2 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1634s21c1
Sequence:CCGGAGAAGAACACAGACGTGGTGGCTCGAGCCACCACGTCTGTGTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-293s21c1
Sequence:CCGGAGTACGGGAAGCCCAACAAGACTCGAGTCTTGTTGGGCTTCCCGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032631.2-1542s21c1
Sequence:CCGGGTTTGCCCTAAAGGTCGACAGCTCGAGCTGTCGACCTTTAGGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-2169s1c1
Sequence:CCGGGCAGGAGAGCAGAGCAGAGAACTCGAGTTCTCTGCTCTGCTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-576s1c1
Sequence:CCGGGCTAAAGATGTCGGTCTCGAACTCGAGTTCGAGACCGACATCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1659s1c1
Sequence:CCGGCTTGAAGAAGATTCGCCGTTACTCGAGTAACGGCGAATCTTCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032631.2-1680s1c1
Sequence:CCGGCAAAGCGAACAAGGACGTAATCTCGAGATTACGTCCTTGTTCGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032631.2-1662s1c1
Sequence:CCGGGAAGAAGATTCGCCGTTACAACTCGAGTTGTAACGGCGAATCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008233
VALIDATED
HDGFRP2 MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-313s21c1
Sequence:CCGGACAAGAGGAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-589s21c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1602s21c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-589s1c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-1652s1c1
Sequence:CCGGGCTGAAGAAGATTCGCCGGTACTCGAGTACCGGCGAATCTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-592s1c1
Sequence:CCGGCAGTCTCTAAACGAGCTAGAACTCGAGTTCTAGCTCGTTTAGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-278s1c1
Sequence:CCGGCTATGATAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-1602s1c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1052s21c1
Sequence:CCGGTGAATGGAAGAGACGTGATGACTCGAGTCATCACGTCTCTTCCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-2077s21c1
Sequence:CCGGAGTCTGCCAATGATGACAATGCTCGAGCATTGTCATCATTGGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008233
VALIDATED
HDGFRP2 MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-313s21c1
Sequence:CCGGACAAGAGGAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-589s21c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1602s21c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-589s1c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-1652s1c1
Sequence:CCGGGCTGAAGAAGATTCGCCGGTACTCGAGTACCGGCGAATCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-592s1c1
Sequence:CCGGCAGTCTCTAAACGAGCTAGAACTCGAGTTCTAGCTCGTTTAGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-278s1c1
Sequence:CCGGCTATGATAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-1602s1c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1052s21c1
Sequence:CCGGTGAATGGAAGAGACGTGATGACTCGAGTCATCACGTCTCTTCCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-2077s21c1
Sequence:CCGGAGTCTGCCAATGATGACAATGCTCGAGCATTGTCATCATTGGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008233
VALIDATED
HDGFRP2 MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-313s21c1
Sequence:CCGGACAAGAGGAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-589s21c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1602s21c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-589s1c1
Sequence:CCGGTGTCAGTCTCTAAACGAGCTACTCGAGTAGCTCGTTTAGAGACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-1652s1c1
Sequence:CCGGGCTGAAGAAGATTCGCCGGTACTCGAGTACCGGCGAATCTTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008233.1-592s1c1
Sequence:CCGGCAGTCTCTAAACGAGCTAGAACTCGAGTTCTAGCTCGTTTAGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-278s1c1
Sequence:CCGGCTATGATAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008233.1-1602s1c1
Sequence:CCGGCTGCAGGTAACCTCTCAGATTCTCGAGAATCTGAGAGGTTACCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-1052s21c1
Sequence:CCGGTGAATGGAAGAGACGTGATGACTCGAGTCATCACGTCTCTTCCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008233.2-2077s21c1
Sequence:CCGGAGTCTGCCAATGATGACAATGCTCGAGCATTGTCATCATTGGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)