EMAIL THIS PAGE TO A FRIEND

HDGFRP3

118 Gene Product Result for
Synonyms: HDGF-2 HDGF2 HRP-3
UniProtKB ID: Q9Y3E1
Gene ID:
Mouse(29877) hepatoma-derived growth factor, related protein 3
Rat(252941) hepatoma-derived growth factor, related protein 3
Zebrafish(497284) hepatoma-derived growth factor, related protein 3
chicken(415463) hepatoma-derived growth factor, related protein 3
cow(784070) hepatoma-derived growth factor, related protein 3
dog(479059) hepatoma-derived growth factor, related protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016073 Rosetta Predictions human pricing
NM_145785 Rosetta Predictions rat pricing
NM_013886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063958 predicted 800
2 SASI_Hs01_00063960 predicted 815
3 SASI_Hs01_00063961 predicted 1004
4 SASI_Hs01_00063962 predicted 1010
5 SASI_Hs01_00063963 predicted 1183
6 SASI_Hs01_00063964 predicted 1103
7 SASI_Hs01_00063965 predicted 1151
8 SASI_Hs01_00063966 predicted 1222
9 SASI_Hs01_00063967 predicted 267
10 SASI_Hs02_00348816 predicted 994
11 SASI_Hs01_00063959 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060045 predicted 733
2 SASI_Rn01_00060046 predicted 430
3 SASI_Rn01_00060047 predicted 736
4 SASI_Rn01_00060048 predicted 770
5 SASI_Rn01_00060049 predicted 575
6 SASI_Rn01_00060050 predicted 792
7 SASI_Rn01_00060051 predicted 763
8 SASI_Rn01_00060052 predicted 759
9 SASI_Rn01_00060053 predicted 561
10 SASI_Rn01_00060054 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322915 predicted 1270
2 SASI_Mm02_00322916 predicted 1177
3 SASI_Mm02_00322917 predicted 1468
4 SASI_Mm02_00322918 predicted 1449
5 SASI_Mm02_00322919 predicted 1406
6 SASI_Mm02_00322920 predicted 1456
7 SASI_Mm02_00322921 predicted 1260
8 SASI_Mm02_00322922 predicted 1108
9 SASI_Mm02_00322923 predicted 1127
10 SASI_Mm02_00322924 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013886
VALIDATED
HDGFRP3 MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-987s21c1
Sequence:CCGGGCTGGCAATGACACGAGAAACCTCGAGGTTTCTCGTGTCATTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1405s21c1
Sequence:CCGGTAGGTGACTGCTCAACATAATCTCGAGATTATGTTGAGCAGTCACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-807s21c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-706s21c1
Sequence:CCGGATAATCCAGGAGTGAAATTTACTCGAGTAAATTTCACTCCTGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1037s21c1
Sequence:CCGGAGGGACCTAACTACCGTAATGCTCGAGCATTACGGTAGTTAGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013886.3-637s1c1
Sequence:CCGGCCGTAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-573s1c1
Sequence:CCGGCGCTGGCAATGACACGAGAAACTCGAGTTTCTCGTGTCATTGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013886.3-141s1c1
Sequence:CCGGTCCAGCAAACAAGTACCCTATCTCGAGATAGGGTACTTGTTTGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-471s1c1
Sequence:CCGGCACGTCAAAGAAGTCTTCTAACTCGAGTTAGAAGACTTCTTTGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-394s1c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013886
VALIDATED
HDGFRP3 MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-987s21c1
Sequence:CCGGGCTGGCAATGACACGAGAAACCTCGAGGTTTCTCGTGTCATTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1405s21c1
Sequence:CCGGTAGGTGACTGCTCAACATAATCTCGAGATTATGTTGAGCAGTCACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-807s21c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-706s21c1
Sequence:CCGGATAATCCAGGAGTGAAATTTACTCGAGTAAATTTCACTCCTGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1037s21c1
Sequence:CCGGAGGGACCTAACTACCGTAATGCTCGAGCATTACGGTAGTTAGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013886.3-637s1c1
Sequence:CCGGCCGTAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-573s1c1
Sequence:CCGGCGCTGGCAATGACACGAGAAACTCGAGTTTCTCGTGTCATTGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013886.3-141s1c1
Sequence:CCGGTCCAGCAAACAAGTACCCTATCTCGAGATAGGGTACTTGTTTGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-471s1c1
Sequence:CCGGCACGTCAAAGAAGTCTTCTAACTCGAGTTAGAAGACTTCTTTGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-394s1c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013886
VALIDATED
HDGFRP3 MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-987s21c1
Sequence:CCGGGCTGGCAATGACACGAGAAACCTCGAGGTTTCTCGTGTCATTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1405s21c1
Sequence:CCGGTAGGTGACTGCTCAACATAATCTCGAGATTATGTTGAGCAGTCACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-807s21c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-706s21c1
Sequence:CCGGATAATCCAGGAGTGAAATTTACTCGAGTAAATTTCACTCCTGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013886.4-1037s21c1
Sequence:CCGGAGGGACCTAACTACCGTAATGCTCGAGCATTACGGTAGTTAGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013886.3-637s1c1
Sequence:CCGGCCGTAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-573s1c1
Sequence:CCGGCGCTGGCAATGACACGAGAAACTCGAGTTTCTCGTGTCATTGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013886.3-141s1c1
Sequence:CCGGTCCAGCAAACAAGTACCCTATCTCGAGATAGGGTACTTGTTTGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-471s1c1
Sequence:CCGGCACGTCAAAGAAGTCTTCTAACTCGAGTTAGAAGACTTCTTTGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013886.3-394s1c1
Sequence:CCGGGAAGAAGGTGATAGAGTAGAACTCGAGTTCTACTCTATCACCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016073
VALIDATED
HDGFRP3 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-389s21c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-619s21c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-1230s21c1
Sequence:CCGGTGGTATATTGAAGACGAAATTCTCGAGAATTTCGTCTTCAATATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-343s21c1
Sequence:CCGGTTCCATATAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTATATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016073.2-771s1c1
Sequence:CCGGCCATAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-619s1c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-275s1c1
Sequence:CCGGAGCAAACAAGTATCCTATCTTCTCGAGAAGATAGGATACTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-712s1c1
Sequence:CCGGGCAACGACACAAGAAACACAACTCGAGTTGTGTTTCTTGTGTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-389s1c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016073
VALIDATED
HDGFRP3 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-389s21c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-619s21c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-1230s21c1
Sequence:CCGGTGGTATATTGAAGACGAAATTCTCGAGAATTTCGTCTTCAATATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-343s21c1
Sequence:CCGGTTCCATATAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTATATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016073.2-771s1c1
Sequence:CCGGCCATAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-619s1c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-275s1c1
Sequence:CCGGAGCAAACAAGTATCCTATCTTCTCGAGAAGATAGGATACTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-712s1c1
Sequence:CCGGGCAACGACACAAGAAACACAACTCGAGTTGTGTTTCTTGTGTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-389s1c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016073
VALIDATED
HDGFRP3 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-389s21c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-619s21c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016073.2-1230s21c1
Sequence:CCGGTGGTATATTGAAGACGAAATTCTCGAGAATTTCGTCTTCAATATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016073.2-343s21c1
Sequence:CCGGTTCCATATAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTATATGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016073.2-771s1c1
Sequence:CCGGCCATAATGAATGCTGCATATTCTCGAGAATATGCAGCATTCATTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-619s1c1
Sequence:CCGGCCTCTAAACAGTCCCGGAAATCTCGAGATTTCCGGGACTGTTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-275s1c1
Sequence:CCGGAGCAAACAAGTATCCTATCTTCTCGAGAAGATAGGATACTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-712s1c1
Sequence:CCGGGCAACGACACAAGAAACACAACTCGAGTTGTGTTTCTTGTGTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016073.2-389s1c1
Sequence:CCGGGAAAGGATTTAACGAAGGATTCTCGAGAATCCTTCGTTAAATCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)