EMAIL THIS PAGE TO A FRIEND

HDHD1

haloacid dehalogenase-like hydrolase domain containing 1

37 Gene Product Result for
Synonyms: DXF68S1E FAM16AX GS1 HDHD1A
Gene ID:
Human(8226) Summary: This gene encodes a member of the haloacid dehalogenase-like (HAD) hydrolase superfamily. The encoded protein has no known biological function. This gene has a pseudogene on chromosome 1. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
Rat(291585) haloacid dehalogenase-like hydrolase domain containing 1
Zebrafish(553642) haloacid dehalogenase-like hydrolase domain containing 1
cow(617253) haloacid dehalogenase-like hydrolase domain containing 1
domestic cat(101082722) haloacid dehalogenase-like hydrolase domain containing 1
dog(610678) haloacid dehalogenase-like hydrolase domain containing 1
chicken(418655) haloacid dehalogenase-like hydrolase domain containing 1
sheep(101118336) haloacid dehalogenase-like hydrolase domain containing 1
naked mole-rat(101718666) haloacid dehalogenase-like hydrolase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
APREST94374 PrEST Antigen PUDP Prestige Antigens Powered by Atlas Antibodies New human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012080 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031381 MISSION® esiRNA esiRNA human HDHD1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012080 Rosetta Predictions human pricing
NM_001106146 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115990 predicted 316
2 SASI_Hs01_00115991 predicted 599
3 SASI_Hs01_00115992 predicted 699
4 SASI_Hs01_00115993 predicted 200
5 SASI_Hs01_00115994 predicted 599
6 SASI_Hs01_00115995 predicted 540
7 SASI_Hs01_00115996 predicted 325
8 SASI_Hs02_00343560 predicted 433
9 SASI_Hs02_00343561 predicted 540
10 SASI_Hs01_00115997 predicted 606
11 SASI_Hs01_00115989 predicted 788
12 SASI_Hs01_00115998 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216078 predicted 540
2 SASI_Rn02_00216079 predicted 733
3 SASI_Rn02_00216080 predicted 676
4 SASI_Rn02_00216081 predicted 218
5 SASI_Rn02_00216082 predicted 216
6 SASI_Rn02_00216083 predicted 391
7 SASI_Rn02_00216084 predicted 798
8 SASI_Rn02_00216085 predicted 670
9 SASI_Rn02_00216086 predicted 538
10 SASI_Rn02_00216087 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012080
VALIDATED
HDHD1 MISSION shRNA Bacterial Glycerol Stock
haloacid dehalogenase-like hydrolase domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012080.4-244s21c1
Sequence:CCGGAGGCGGCACAGATTATAATAGCTCGAGCTATTATAATCTGTGCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-270s21c1
Sequence:CCGGTTGCAGCTCCCGATGTCCAAACTCGAGTTTGGACATCGGGAGCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-914s21c1
Sequence:CCGGCCCAGTCTAACGTGTTGATAACTCGAGTTATCAACACGTTAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-370s21c1
Sequence:CCGGTCATCATCCACCTGCGGAAACCTCGAGGTTTCCGCAGGTGGATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-1093s21c1
Sequence:CCGGGTGTATCAGTTTGGTAATATGCTCGAGCATATTACCAAACTGATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-136s21c1
Sequence:CCGGTGGATACTGAACGGCTGTATTCTCGAGAATACAGCCGTTCAGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-178s21c1
Sequence:CCGGGTAATCGCTATGACAAGAAATCTCGAGATTTCTTGTCATAGCGATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-447s1c1
Sequence:CCGGCCAGACATCTTCCTAGCTTGTCTCGAGACAAGCTAGGAAGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-73s1c1
Sequence:CCGGCAGTGGTGTTTCAAGAAATATCTCGAGATATTTCTTGAAACACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-138s1c1
Sequence:CCGGGTTATGGGTAAGAAGGCATTACTCGAGTAATGCCTTCTTACCCATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012080.1-346s1c1
Sequence:CCGGCGTCGTTCGATATGAAGACAACTCGAGTTGTCTTCATATCGAACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-579s1c1
Sequence:CCGGGACGGAAACTTGAGCCGAGATCTCGAGATCTCGGCTCAAGTTTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012080
VALIDATED
HDHD1 MISSION shRNA shRNA Plasmid DNA
haloacid dehalogenase-like hydrolase domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012080.4-244s21c1
Sequence:CCGGAGGCGGCACAGATTATAATAGCTCGAGCTATTATAATCTGTGCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-270s21c1
Sequence:CCGGTTGCAGCTCCCGATGTCCAAACTCGAGTTTGGACATCGGGAGCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-914s21c1
Sequence:CCGGCCCAGTCTAACGTGTTGATAACTCGAGTTATCAACACGTTAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-370s21c1
Sequence:CCGGTCATCATCCACCTGCGGAAACCTCGAGGTTTCCGCAGGTGGATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-1093s21c1
Sequence:CCGGGTGTATCAGTTTGGTAATATGCTCGAGCATATTACCAAACTGATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-136s21c1
Sequence:CCGGTGGATACTGAACGGCTGTATTCTCGAGAATACAGCCGTTCAGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-178s21c1
Sequence:CCGGGTAATCGCTATGACAAGAAATCTCGAGATTTCTTGTCATAGCGATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-447s1c1
Sequence:CCGGCCAGACATCTTCCTAGCTTGTCTCGAGACAAGCTAGGAAGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-73s1c1
Sequence:CCGGCAGTGGTGTTTCAAGAAATATCTCGAGATATTTCTTGAAACACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-138s1c1
Sequence:CCGGGTTATGGGTAAGAAGGCATTACTCGAGTAATGCCTTCTTACCCATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012080.1-346s1c1
Sequence:CCGGCGTCGTTCGATATGAAGACAACTCGAGTTGTCTTCATATCGAACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-579s1c1
Sequence:CCGGGACGGAAACTTGAGCCGAGATCTCGAGATCTCGGCTCAAGTTTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012080
VALIDATED
HDHD1 MISSION shRNA Lentiviral Transduction Particles
haloacid dehalogenase-like hydrolase domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012080.4-244s21c1
Sequence:CCGGAGGCGGCACAGATTATAATAGCTCGAGCTATTATAATCTGTGCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-270s21c1
Sequence:CCGGTTGCAGCTCCCGATGTCCAAACTCGAGTTTGGACATCGGGAGCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-914s21c1
Sequence:CCGGCCCAGTCTAACGTGTTGATAACTCGAGTTATCAACACGTTAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-370s21c1
Sequence:CCGGTCATCATCCACCTGCGGAAACCTCGAGGTTTCCGCAGGTGGATGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-1093s21c1
Sequence:CCGGGTGTATCAGTTTGGTAATATGCTCGAGCATATTACCAAACTGATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-136s21c1
Sequence:CCGGTGGATACTGAACGGCTGTATTCTCGAGAATACAGCCGTTCAGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012080.4-178s21c1
Sequence:CCGGGTAATCGCTATGACAAGAAATCTCGAGATTTCTTGTCATAGCGATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-447s1c1
Sequence:CCGGCCAGACATCTTCCTAGCTTGTCTCGAGACAAGCTAGGAAGATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-73s1c1
Sequence:CCGGCAGTGGTGTTTCAAGAAATATCTCGAGATATTTCTTGAAACACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-138s1c1
Sequence:CCGGGTTATGGGTAAGAAGGCATTACTCGAGTAATGCCTTCTTACCCATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012080.1-346s1c1
Sequence:CCGGCGTCGTTCGATATGAAGACAACTCGAGTTGTCTTCATATCGAACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012080.1-579s1c1
Sequence:CCGGGACGGAAACTTGAGCCGAGATCTCGAGATCTCGGCTCAAGTTTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)