EMAIL THIS PAGE TO A FRIEND

HDHD3

haloacid dehalogenase-like hydrolase domain containing 3

51 Gene Product Result for
Synonyms: 2810435D12Rik C9orf158
UniProtKB ID: Q9BSH5, B2RD47
Gene ID:
Mouse(72748) haloacid dehalogenase-like hydrolase domain containing 3
Rat(688746) haloacid dehalogenase-like hydrolase domain containing 3
domestic guinea pig(100733292) haloacid dehalogenase-like hydrolase domain containing 3
naked mole-rat(101702411) haloacid dehalogenase-like hydrolase domain containing 3
sheep(101106823) haloacid dehalogenase-like hydrolase domain containing 3
Zebrafish(553464) haloacid dehalogenase-like hydrolase domain containing 3
chicken(417273) haloacid dehalogenase-like hydrolase domain containing 3
domestic cat(101096424) haloacid dehalogenase-like hydrolase domain containing 3
cow(510680) haloacid dehalogenase-like hydrolase domain containing 3
dog(481683) haloacid dehalogenase-like hydrolase domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154951 MISSION® esiRNA esiRNA human HDHD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031219 Rosetta Predictions human pricing
NM_001109511 Rosetta Predictions rat pricing
NM_024257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040289 predicted 1444
2 SASI_Hs01_00040290 predicted 1230
3 SASI_Hs01_00040291 predicted 1441
4 SASI_Hs01_00040292 predicted 1236
5 SASI_Hs01_00040293 predicted 1348
6 SASI_Hs01_00040294 predicted 1406
7 SASI_Hs01_00040295 predicted 1124
8 SASI_Hs01_00040296 predicted 1028
9 SASI_Hs01_00040297 predicted 1333
10 SASI_Hs01_00040298 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249119 predicted 494
2 SASI_Rn02_00249120 predicted 286
3 SASI_Rn02_00249121 predicted 404
4 SASI_Rn02_00249122 predicted 925
5 SASI_Rn02_00249123 predicted 954
6 SASI_Rn02_00249124 predicted 419
7 SASI_Rn02_00249125 predicted 686
8 SASI_Rn02_00249126 predicted 449
9 SASI_Rn02_00249127 predicted 326
10 SASI_Rn02_00249128 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147225 predicted 765
2 SASI_Mm01_00147226 predicted 856
3 SASI_Mm01_00147227 predicted 394
4 SASI_Mm01_00147228 predicted 516
5 SASI_Mm01_00147229 predicted 222
6 SASI_Mm01_00147230 predicted 487
7 SASI_Mm01_00147231 predicted 614
8 SASI_Mm02_00327646 predicted 508
9 SASI_Mm01_00147232 predicted 602
10 SASI_Mm01_00147233 predicted 471
11 SASI_Mm01_00147224 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031219
VALIDATED
HDHD3 MISSION shRNA Bacterial Glycerol Stock
haloacid dehalogenase-like hydrolase domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1232s1c1
Sequence:CCGGCTGCGTGAACACTTCGACTTTCTCGAGAAAGTCGAAGTGTTCACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1175s1c1
Sequence:CCGGCTGGCAGTGATCTCCAACTTTCTCGAGAAAGTTGGAGATCACTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1448s1c1
Sequence:CCGGAGGGATTCTGTACCTAAAGAACTCGAGTTCTTTAGGTACAGAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031219.2-1439s1c1
Sequence:CCGGCCCGTGGTCAGGGATTCTGTACTCGAGTACAGAATCCCTGACCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1071s1c1
Sequence:CCGGCCATCGCTGAACAGCTTTATACTCGAGTATAAAGCTGTTCAGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031219
VALIDATED
HDHD3 MISSION shRNA shRNA Plasmid DNA
haloacid dehalogenase-like hydrolase domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1232s1c1
Sequence:CCGGCTGCGTGAACACTTCGACTTTCTCGAGAAAGTCGAAGTGTTCACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1175s1c1
Sequence:CCGGCTGGCAGTGATCTCCAACTTTCTCGAGAAAGTTGGAGATCACTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1448s1c1
Sequence:CCGGAGGGATTCTGTACCTAAAGAACTCGAGTTCTTTAGGTACAGAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031219.2-1439s1c1
Sequence:CCGGCCCGTGGTCAGGGATTCTGTACTCGAGTACAGAATCCCTGACCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1071s1c1
Sequence:CCGGCCATCGCTGAACAGCTTTATACTCGAGTATAAAGCTGTTCAGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031219
VALIDATED
HDHD3 MISSION shRNA Lentiviral Transduction Particles
haloacid dehalogenase-like hydrolase domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1232s1c1
Sequence:CCGGCTGCGTGAACACTTCGACTTTCTCGAGAAAGTCGAAGTGTTCACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1175s1c1
Sequence:CCGGCTGGCAGTGATCTCCAACTTTCTCGAGAAAGTTGGAGATCACTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1448s1c1
Sequence:CCGGAGGGATTCTGTACCTAAAGAACTCGAGTTCTTTAGGTACAGAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031219.2-1439s1c1
Sequence:CCGGCCCGTGGTCAGGGATTCTGTACTCGAGTACAGAATCCCTGACCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_031219.2-1071s1c1
Sequence:CCGGCCATCGCTGAACAGCTTTATACTCGAGTATAAAGCTGTTCAGCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024257
VALIDATED
HDHD3 MISSION shRNA Bacterial Glycerol Stock
haloacid dehalogenase-like hydrolase domain containing 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-773s1c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-857s21c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-400s21c1
Sequence:CCGGTGGCCTTACTTCCCGTCAATGCTCGAGCATTGACGGGAAGTAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-872s1c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-866s1c1
Sequence:CCGGGATTCTGTACCTAAGGAACATCTCGAGATGTTCCTTAGGTACAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-773s21c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-872s21c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-696s21c1
Sequence:CCGGCTAAACCCGACCCACGGATTTCTCGAGAAATCCGTGGGTCGGGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-488s1c1
Sequence:CCGGGTTGCTGACCAGCTATACGAACTCGAGTTCGTATAGCTGGTCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-876s1c1
Sequence:CCGGCTAAGGAACATATTCTACCCTCTCGAGAGGGTAGAATATGTTCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-857s1c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-623s1c1
Sequence:CCGGGAGGATATCCTAACAGGCCTTCTCGAGAAGGCCTGTTAGGATATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024257
VALIDATED
HDHD3 MISSION shRNA shRNA Plasmid DNA
haloacid dehalogenase-like hydrolase domain containing 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-773s1c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-857s21c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-400s21c1
Sequence:CCGGTGGCCTTACTTCCCGTCAATGCTCGAGCATTGACGGGAAGTAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-872s1c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-866s1c1
Sequence:CCGGGATTCTGTACCTAAGGAACATCTCGAGATGTTCCTTAGGTACAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-773s21c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-872s21c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-696s21c1
Sequence:CCGGCTAAACCCGACCCACGGATTTCTCGAGAAATCCGTGGGTCGGGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-488s1c1
Sequence:CCGGGTTGCTGACCAGCTATACGAACTCGAGTTCGTATAGCTGGTCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-876s1c1
Sequence:CCGGCTAAGGAACATATTCTACCCTCTCGAGAGGGTAGAATATGTTCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-857s1c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-623s1c1
Sequence:CCGGGAGGATATCCTAACAGGCCTTCTCGAGAAGGCCTGTTAGGATATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024257
VALIDATED
HDHD3 MISSION shRNA Lentiviral Transduction Particles
haloacid dehalogenase-like hydrolase domain containing 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-773s1c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-857s21c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-400s21c1
Sequence:CCGGTGGCCTTACTTCCCGTCAATGCTCGAGCATTGACGGGAAGTAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-872s1c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-866s1c1
Sequence:CCGGGATTCTGTACCTAAGGAACATCTCGAGATGTTCCTTAGGTACAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-773s21c1
Sequence:CCGGGATAGTTACCTCTGTGATTACCTCGAGGTAATCACAGAGGTAACTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-872s21c1
Sequence:CCGGGTACCTAAGGAACATATTCTACTCGAGTAGAATATGTTCCTTAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024257.1-696s21c1
Sequence:CCGGCTAAACCCGACCCACGGATTTCTCGAGAAATCCGTGGGTCGGGTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-488s1c1
Sequence:CCGGGTTGCTGACCAGCTATACGAACTCGAGTTCGTATAGCTGGTCAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024257.1-876s1c1
Sequence:CCGGCTAAGGAACATATTCTACCCTCTCGAGAGGGTAGAATATGTTCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-857s1c1
Sequence:CCGGGCAGTCAGAGATTCTGTACCTCTCGAGAGGTACAGAATCTCTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024257.1-623s1c1
Sequence:CCGGGAGGATATCCTAACAGGCCTTCTCGAGAAGGCCTGTTAGGATATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)